[Boards: 3 / a / aco / adv / an / asp / b / bant / biz / c / can / cgl / ck / cm / co / cock / d / diy / e / fa / fap / fit / fitlit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mlpol / mo / mtv / mu / n / news / o / out / outsoc / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / spa / t / tg / toy / trash / trv / tv / u / v / vg / vint / vip / vp / vr / w / wg / wsg / wsr / x / y ] [Search | Free Show | Home]

Biochemists - Amplifying oligo with high GC?

This is a blue board which means that it's for everybody (Safe For Work content only). If you see any adult content, please report it.

Thread replies: 6
Thread images: 2

What's the best way to amplify DNA with high GC content? Here's the sequence.

5' GCACCGGGCAGGGACGTCCGGGAGGGC 3'

Also, I'm designing primers right now, and I know the standard is usually 18-22 bp. Given that this is so small, what do? I'm an undergraduate and I haven't had a lot of experience running PCR on oligos. Thanks.
>>
http://bitesizebio.com/24002/problems-amplifying-gc-rich-regions-problem-solved/
>>
>>8463934
Thanks mate. I actually just read this earlier. However, I have found very little information regarding the design of primers for a sequence so small. Any input would be immensely helpful.
>>
>I know the standard is usually 18-22 bp
in cases like this, fuck the standard

what matters is GC, Tm, and specificity. If you can find a shorter primer that has a reasonable GC content and Tm but is still specific to your sequence, there's no reason not to at least try it. Primers are cheap.

in this case though, what I'd do is just try to change up my project so I avoided that problem sequence. You'll waste more time trying to optimize this trouble primer and the PCR reaction than you would just tossing a little work out and avoiding the problem in the first place.
>>
>>8463974
Unfortunately this oligo sequence is that of an aptamer so the sequence is necessary to target our target protein.

I can try to to make short primers, but I'm worried that they will anneal to other locations other than the 5' and 3' end. Thanks for the input though
>>
File: 0szo38e6.jpg (38KB, 356x600px) Image search: [Google]
0szo38e6.jpg
38KB, 356x600px
>>8463850

Use a Tm calculator to annealing temperature.

For your primer, its high (about 75C). So, use something like DMSO to get it down. about 0.6C per 1% v/v.

So at 10% DMSO you'll be at 69, more like it eh. DMSO reduces reaction efficiency so you'll want more Taq or more cycles but not more than 10 units of Taq per 25ul reaction volume or 35 cycles.

Proitp: Break the reaction volumes in half or more, like 10ul, and use intermediate annealing temperature with DMSO in gradients of 2% to conserve template, reagent and primer.

When you get a good band realize you'll have to cut the band or clean it up to remove the DMSO
Thread posts: 6
Thread images: 2


[Boards: 3 / a / aco / adv / an / asp / b / bant / biz / c / can / cgl / ck / cm / co / cock / d / diy / e / fa / fap / fit / fitlit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mlpol / mo / mtv / mu / n / news / o / out / outsoc / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / spa / t / tg / toy / trash / trv / tv / u / v / vg / vint / vip / vp / vr / w / wg / wsg / wsr / x / y] [Search | Top | Home]

I'm aware that Imgur.com will stop allowing adult images since 15th of May. I'm taking actions to backup as much data as possible.
Read more on this topic here - https://archived.moe/talk/thread/1694/


If you need a post removed click on it's [Report] button and follow the instruction.
DMCA Content Takedown via dmca.com
All images are hosted on imgur.com.
If you like this website please support us by donating with Bitcoins at 16mKtbZiwW52BLkibtCr8jUg2KVUMTxVQ5
All trademarks and copyrights on this page are owned by their respective parties.
Images uploaded are the responsibility of the Poster. Comments are owned by the Poster.
This is a 4chan archive - all of the content originated from that site.
This means that RandomArchive shows their content, archived.
If you need information for a Poster - contact them.