What's the best way to amplify DNA with high GC content? Here's the sequence.
5' GCACCGGGCAGGGACGTCCGGGAGGGC 3'
Also, I'm designing primers right now, and I know the standard is usually 18-22 bp. Given that this is so small, what do? I'm an undergraduate and I haven't had a lot of experience running PCR on oligos. Thanks.
http://bitesizebio.com/24002/problems-amplifying-gc-rich-regions-problem-solved/
>>8463934
Thanks mate. I actually just read this earlier. However, I have found very little information regarding the design of primers for a sequence so small. Any input would be immensely helpful.
>I know the standard is usually 18-22 bp
in cases like this, fuck the standard
what matters is GC, Tm, and specificity. If you can find a shorter primer that has a reasonable GC content and Tm but is still specific to your sequence, there's no reason not to at least try it. Primers are cheap.
in this case though, what I'd do is just try to change up my project so I avoided that problem sequence. You'll waste more time trying to optimize this trouble primer and the PCR reaction than you would just tossing a little work out and avoiding the problem in the first place.
>>8463974
Unfortunately this oligo sequence is that of an aptamer so the sequence is necessary to target our target protein.
I can try to to make short primers, but I'm worried that they will anneal to other locations other than the 5' and 3' end. Thanks for the input though
>>8463850
Use a Tm calculator to annealing temperature.
For your primer, its high (about 75C). So, use something like DMSO to get it down. about 0.6C per 1% v/v.
So at 10% DMSO you'll be at 69, more like it eh. DMSO reduces reaction efficiency so you'll want more Taq or more cycles but not more than 10 units of Taq per 25ul reaction volume or 35 cycles.
Proitp: Break the reaction volumes in half or more, like 10ul, and use intermediate annealing temperature with DMSO in gradients of 2% to conserve template, reagent and primer.
When you get a good band realize you'll have to cut the band or clean it up to remove the DMSO