I got a PS4 for christmas. What about you /v/?
>cat tries to save its master
>dog literally does nothing
Things like this is why I always have the urge to strangle any cat I see.
>>361731001
that cat is a metaphor for the movies he's about to watch
>>361731001
Is that guy special? Who the fuck reacts like that at his age?
>>361731129
>cat is so socially retarded it attacks it's owner when it's owner is excited because it doesn't understand
>dog knows his owner is happy and excited and stands nearby wagging tail, happy for him, letting him do his thing
>>361731129
more like
>dog is being legitimately happy for his seemingly happy master, being the loyal friend like all dogs are
>cat is being a fucking retard like all cats
>>361731278
dog = pirates
cat = psn
>>361731335
>>361731341
>dogs ears are back
>looks terrified
uh huh, keep telling yourself that
Fucking cats kill them all
>getting presents for christmas
y-yeah...
why are cats so retarded?
>>361731393
>never seen a excited and curious dog
>>361731393
>>361731341
>>361731335
>>361731129
please stop calling that rat a dog
>>361731457
Look at him, he wants to do something but he's too much of a little bitch. The dog is literally pissing himself while the cat takes action like a champ
>>361731335
>>361731341
Cats have sensitive hearing, that manchild went from nothing to yelling and ripping open a present and that shit is loud. It's his own retarded fault for getting attacked.
>>361731278
>le movie meme
you're pathetic kid
>>361731129
cats are pieces of shit
dogs are infinitely better
>>361731001
that's hilarious
>>361731001
Cats are worse than women. All they do is take shit for granted and bitch at everything.
r8 my cat, /v/
>>361731528
dog respects the owner and won't do anything until he fully understands the situation, while the cat is just autistic and can't interpret his masters actions.
>>361731461
small dogs are cute. CUTE.
The cat was giving him a big hug as he's always wanted a quality game console too.
>>361731001
got some chocolates and booze
>>361731402
>Buying a PS4
>Uncharted 4
>That haircut
Why are cats so based?
>>361731001
I might get myself a second (phat) PS2. PS4 can wait a year or two.
>>361731528
No, the dog is excited because he sees his owner getting super hyper about a box and is carefully approaching to investigate what its owner is so excited about
The cat doesn't understand humans at all, doesn't make the connection between the owner and the box and freaks out because cats are retarded when it comes to socializing
>>361731549
i could only play maybe 4 of these games at best from this trash pile
>>361731704
The dog is literally retarded though.
>>361731001
There is something wrong with that cat.
>>361731402
Definitely deserved it.
Look at that faggot.
>>361731001
So many emotions in under 10 seconds, holy shit.
>>361731545
You're just as socially inept as the fucking cat. Loud noises =/= target to attack.
>stop being a faggot REEEEEEEEEEEEE
based kitter
>>361731001
I just got autism
>>361731001
>that haircut
>sonygger
>owns a dog
Guy definitely deserved it.
>>361731402
Such a fucking pussy. This is why people can't even own cats. They basically take care of themselves but people haven't read ANYTHING about the pets they own.
>Own a cat named squeaks
>he's a fat cat
>love him to death
>scared that he's going to die soon if he doesn't lose weight
>>361731549
Nice pile of garbage.
Sucks if the cat bit him, cat bites nearly always cause infection.
>>361731773
Nah, there's something wrong with the person.
>manchild gets ps4
>cat is pissed off it got such a shit console
>attacks retard for being a sonycuck
Cats are good
>>361731001
Nothing, just as expected, not even company.
Trying not to kill myself.
>>361731771
The cat moreso. At least the dog understands the situation. The cat just flips out and attacks for no reason.
>>361731818
It's all your fault. Stop overfeeding your cat, control his/her portions and play with the darn animal.
>>361731405
We all have to grow up anon.
I still got a box of chocolates.
>>361731895
More like manchild overreacting that he got a console he could've bought with his own money for Christmas.
>>361731001
My cat died.
>>361731549
>le convince PS4 doesn't have movie memes
>show movie memes
T-Thanks...
>>361731001
If a dog was the one doing that everyone would be shouting KILL THAT DOG, but because it's a cat, we have catfags making up bullshit excuses.
Cats are dicks, cats don't love, cats only use you.
Having a cat = being a cuck.
>>361731818
that is adorable
>>361731818
Put him on a strict diet, feed him a food specifically designed for weight loss. It can be expensive, but the specialty foods from a reputable brand work well.
>>361731001
Had two cats, they always reacted with aggression to many things, stranger takes them to pet, laugh and screams.
I seen cats attacking some woman and making her hide behind the door.
My neighbour was with her friend laughing loudly when cat under the table ripped her legs so hard she needed many stitches.
No idea whats with cats and attacking everything, its not even weird to see a cat chasing dogs, horses or some strayan animal.
Loved my two cats but fuck their unpredictability was always a bit unsettling.
You fucking pet it and everything is ok, murmur and what now and suddenly cat just grabs your hands pull it toward himself starts biting the everloving fuck out of it while with rear paws fully clawed it pushes it away.
>>361731624
owo what's this/10
>>361731924
The dog doesn't understand the situation at all.
>>361731549
I wish you were my friend so I could borrow some games anon.
>>361731549
Get better movies
I really don't understand why people get pets. All you're doing is wasting your money feeding them and taking care of them and cleaning up their shit and there's always the chance that they'll attack you because they're stupid animals. I think owning pets should be illegal.
I've had a lot of dogs in my life, and no bullshit, the dog is happy and excited, but unsure of why exactly his owner is flipping out like an idiot, so doesn't exactly know HOW to react, which is why he's keeping his distance a bit for now.
I've also had a handful of cats, and not a single one of them has attacked me like that. Probably because I've also not once chimped out and made wild movements around an animal which does NOT appreciate it when other beings freak the fuck out near them.
Dog is happy but confused, cat is unsettled and put on edge... because it's a cat.
I got a sweet ass Carpenter Brut x Perturbator poster, a GTX 1060 and a book about Dark Souls.
Pic related.
>>361731402
but a-anon... dont kill the catgirls like me
>>361731985
uh huh
yeah
tell me about it
>>361731946
>>361731895
>Adults don't give gifts to one another
Get friends
Why do so many people have retarded autist cats? My cat's never even hissed at me.
>>361731129
the cat was trying to save the PS4
don't you see how much he's shaking the damn thing
>>361731001
xcom 2 for ps4 since my laptop probably cant run it
>>361732018
Most cats aren't aggressive though.
There's usually a linkage between non-neutered male cats and aggression though.
>everyone thinks that guy is the cats owner
either that cat has something wrong with it(abused rescue mental etc) or that guy is just some poor boyfriend getting attacked by his girlfriends asshole cat
make no fucking mistake cats are domesticated just like dogs and just like dogs they require training
>>361731001
It's not christmas yet for me, but, like always:
nothing.
>>361732072
very nice.
Cats are shit.
>>361731704
Dogs don't even understand the concept of being excited. He was just checking to see if there was any food nearby.
>>361732014
>>361731818
My suggestion because I only have experience with that brand would be a food from Science Diet such as the metabolic brand or I think W/D would work too. Like I said, it's expensive, but if you stick to proper portions it will work.
>>361732018
>laughing loudly
>No idea whats with cats and attacking everything
Really activates my almonds... It's like all those stupid fucks that tries to pet every cat they see when they're outside and then bitch they get bitten. It's their own fucking fault.
>>361732056
I can't begin to imagine the fucked up life you lead just from reading this post alone.
Why do dogfags get so angry whenever they see a cat? Are they all retarded?
>>361732134
i want a small kitten that jumps on me and attacks me, shits adorable
>>361732087
Boss ass cat
Holy shit
>>361731818
My cat went from 20 lbs down to 9, a healthy weight. You can do it. Start that diet for New Year's.
>>361732134
Man are cats really that big?
I won a shooter glass roulette for the gift exchange, but I don't really get gifts on Christmas other than that.
>>361731549
>Monopoly Family Fun Pack
Okay, either you are a retard or this is the photo some gamestop employee took when sorting videogames or something
>>361732072
>listening to meme tunes
kys my man
>>361731549
Nice PC games fag
>>361732237
cats are snakes
>>361732237
This.
Dogfags are so insecure it's unreal
>>361731549
most of those games are on PS3, nice job cuck. god i'm so fucking glad i didn't waste money on an 8th gen.
>>361731001
>human acting like a retard for the sake of internet fame
>cat gets tired of their shit and decides to finish it all
>probably mad that he failed and gonna try again on New Year
This is why cats are the best.
>>361731545
>Cats have sensitive hearing
So they really are just furry autists.
>>361731001
>Cat see the shit game and shit console
>Remember that his owner have shit taste and a shit haircut
>Then it proceed to give the best Christmas gift that a faggot like him could have.
>The cat attacks him so he can know how much of a faggot he is and can start to have a better life.
That cat did nothing wrong, he was just helping his master.
>>361732029
Dogs have been proven to be able to recognize moods and emotions expressed by humans based on social cues and facial expression
The dog clearly knows everything is fine and just wants to see what the box making the owner so excited is, approaching it carefully and sniffing it
>>361732087
Cats are fucking based.
They sort of make it on their own but also kinda need you but when you have a cat you tell by the way it behaved that he likes you. They stick close to you, sit on your lap, rub all over you, meow at you, play with you.. hey are just not full Oh MY FUCKING GOD YES mode all the time like dogs are.
>>361731549
wow what a pile of garbage
How many relationships has that monopoly game ruined?
>>361732056
I agree, and ive had many different pets.
>>361731817
>They basically take care of themselves but people haven't read ANYTHING about the pets they own.
As someone who have never owned a cat, what should he have known about them exactly?
>>361732097
Because people get cats expecting them to be like dogs and end up pissing them off and giving them anxiety issues instead of treating them like a roommate that just wants to keep to itself.
>>361732372
You can't prove that that dog knows what the situation is about though.
>b-but it's proven
You still can't prove anything from that webm alone. It could be afraid for all we know and mostly likely is.
>>361732379
now I know you're gay
>>361732436
>treating an animal like a human being
Catfags everyone.
>>361731001
I fucking love that cat
>>361731001
Holy shit that's why I own no cats, the look cool but they can fuck your shit up with those claws, very dangerous and I remember that when a cat wags its tail it means your shit is gonna get fucked up.
>>361732087
>Posting the same gif since 10 years ago.
>While there are hundreds if not thousands of videos showing cats attacking children, owners, other pets.
A black person doing something good doesn't make up for thousands of niggers killing and mugging.
>>361731549
theres literally like 12 good games there. What a waste of money.
>buying disk versions of iOS ports
HA
>>361732056
Because they're beautiful creatures that offer friendship and can give you inspiration and a different perspective on life. Also they'll never bullshit you as bad as a human.
Keeping pets in tiny apartments is kinda retarded though
>>361732189
>never owned a dog
and I guess all those videos of dogs getting extremely excited and happy because they are seeing someone they cared for that they haven't seen in years are just the dog thinking the person has food?
>>361732238
This reminds me of a litter of kittens I raised once.
I made sure to give them lots of love and attention until it was time to be adopted.
When someone came and was interested in them, I didn't have to carry them. I didn't have to coerce them. They followed me, single file, to the kitchen. When they met the prospective adopter, they immediately clung to their leg and started purring and affectionately cuddling. They immediately adopted two that day. Probably the two most well behaved cats I've ever seen.
>>361732134
>That cat that does a stone cold stunner
Incredible.
>>361732431
That they should be treated like fragile, highly sensitive autistic children.
>>361732526
>>Posting the same gif since 10 years ago.
>>While there are hundreds if not thousands of videos showing dogs attacking children, owners, other pets.
>>361732018
You need to show the cats who is the boss. Grab cat by the neck and push it against the ground when it goes full assault and real soon it will realize that you are too strong.
I've had two cats and both of them turned from psycho to a nicest person youll ever meet with this method.
>>361732436
Then what's the point of having a cat that doesn't love you and wants you to get the fuck out
>>361732319
What exactly makes this a meme tune ?
I can agree with vaprowave being meme music because that's pretty much what it is, but synthwave is pretty decent, especially Carpenter Brut and Perturbator, which are arguably the best two of the whole genre.
I've seen CB twice this year and this were the two best shows I've ever been to.
>>361732436
really makes your neurons fire up
>can't make a loud noise without the pet attacking you
Having a cat sounds like fun.
>>361731985
Bullshit. Dogs and cats can love you equally, it's just that dogs are way more animated, active and obnoxious when it comes to their emotions. Cats are not like that, but show their affection in much more smaller and subtle ways, or depending on the cat, not so subtle.
I had a cat who used to crawl up onto my shoulders, hug my head, and clean my hair. Even when I was fresh out of the shower.
They're both great.
>>361732237
why do catfags defend the shitty, asshole nature of cats? Are they all cucked?
>want a dog
>can't get any good breed because Florida is too hot
>>361732351
Fuck cats
Dogs 4 life
>>361732598
>changing a word
>LOOK MOM HOW RIGHT I AM
>>361731402
i was really pushy toward my cat and even though she often scratched or bited me i never had her attack me like that
>>361732467
Wanna do lewd things together anon?
Santa watches you all year but the new year hasn't begun yet.. we won't get into the naughty list for 2017 because it's not 2017 yet.
>>361732706
Doesn't make it any less true :^)
>>361732619
If they like you enough they'll come to you when they want attention and won't mind if you do the same.
>>361732526
So how are white people making up for all people they've killed, cultures they've crushed , and land they've stolen? You know since one person accounts for everyone now.
>>361732431
He didn't even notice his cat was on attack mode for one thing. Any non-retard would have seen that shit coming from a mile away. Cats are still predators and they will attack you if you do stupid shit like this. Before my cat died he trusted me completely and would always sleep next to me, before that he always kept his distance. tldr - owning any pet means you should read about the species, plenty of dog\cat owners do retarded shit and then blame the pet for their own mistakes. I bet 50 dollars this retard blamed the cat for attacking him.
I'm planning to move out to a very isolated part of my town, with the open desert literally being a few meter away from my backyard. I was wondering, is getting a cat a good idea?
I know they don't require a lot of attention like dogs, which it's a plus since I spend most of the day on my job. But can you make them really aggressive?
Because if I plan to keep the vermin out of my house, might as well teach it how to attack intruders.
>>361732189
I'm the only one that doesn't feed my dog any food that isn't dogfood and he gets most excited when he hasn't seen me for a while. Get fucked you loveless piece of shit
>TFW want a pet
>live in a small apartment
Is there a little animal you guys recommend that's nice to have and play with?
>>361732018
you raised them wrong. Just you mentioning you had two cats and they both behaved like that it is simple to see you were the problem, not them. Cats are fucking friendly as fuck if you just show you care for them
>>361732018
I have seven cats and only one of them ever gets remotely aggressive. And that's only when one of the others gets near her because she's grumpy and just wants to sleep all day. A few of them even cuddle up with the dog.
>>361731402
Thumbnail looks like he's got a tongue growing out the side of his head.
>>361732649
If having loud autistic outbursts is the norm for you, you might just wanna go with a dog.
that's what he gets for being an infantile faggot
>>361732703
>that thing
>a dog
>>361732443
It's a dog, it knows the human is just expressing happiness/excitement about an object and wants to know what the object is. The body language of the dog is showing it's clearly not afraid, it's clearly excited and curious.
It's clear now you've never been around a dog or care enough to learn about them, but act like an expert anyway. This is an animal that has evolved under our hand for thousands of years and is closely woven to our social behaviors
>>361732319
>meme [x]
>kys
You have to be 18 to use this website
It's also not required but encouraged to stop using this website if you are mentally deficient
>>361732653
What you say can be true about YOUR cat. There can be exceptions, like people having a tiger as a pet and that tiger NEVER attacking the owner.
Does that mean anyone can have a tiger and they will never be attacked?
There are exeptions.
>>361732797
>I have seven cats
Why.
>>361732657
Same reason dogfags get defensive every time a pitbull mauls a small child I would imagine.
>>361732785
cat
>>361732769
fucking HOW
>>361732853
Its called a muffin
I have a piece of shit cat like that. i also have another cat who is really sweet, will walk up to you and roll around on the floor in front of you to show peace. if you lie down near it she will come to you and sleep on you for body warmth, its cute. but the other dumbass cat pounces on it from corners and generally approaches it in a terrible manner. turns the sweet cat into a she devil, its pretty fucking hilarious desu.
cata are seriously retarded. take it from a cat owner. they are not sensible at all, theyre stuck in their own little worlds.
>>361732785
Small bunnies.
>>361732853
>>361731001
>Cat sees opportunity to fuck up a faggot and takes it
>Dog runs off like a chump
>>361732616
You fucker, dont give advices like that, who ever tries that with a cat gets skinned alive.
In part I find cats and dogs to be like woman and man.
Man - dogs, they just need to protect, or fight back, usually they dont go beyond whats necessary.
The moment the other dogs lower its head and crawl, the stronger dog lets go.
Cats are woman, they go apeshit because they know they wont get punished no matter what.
The most damaging attacks, the one that will leave badly healing scars for months after the attack.
Fingernails in the eyes kind of bitches.
Loved my cats but holly fuck you can piss of a dog if you want, it will bite one and will sit there in shock he bit his owner.
The cat will fuck you up for good and unless you willing to get rid of the fucker prepare to be his bunk bitch for the rest of his 12 year old life.
>>361732753
>So how are white people making up
By creating societies where non-whites have it better than in their native countries.
You're welcome, Juan.
>>361732797
>I have seven cats
Sounds like a nightmare.
I had problems with them breeding out of control in my house once. It got really bad at one point. At one point we had as many as 12 or 13.
It's awful. Spay and neuter your pets as soon as possible or they breed out of control.
>>361731549
I own a PS4 myself, but I hate it when people post every single fucking game on the PS4 trying to prove that having games means having good games
>>361731818
I feel that fat cat pain ;_;
>>361732951
>bunnies
No thanks
Pic related
>>361732820
>never laughed loudly
You don't have any friends, do you? Oh yeah, you're a catfag.
>>361731549
wow... its nothing
>>361732304
For you.
>>361731001
>>361732856
>This is an animal that has evolved under our hand for thousands of years and is closely woven to our social behaviors
This.
We haven't really domesticated cats in the same way though, they never did much besides being cute and hanging around eating rats. We used dogs for more active purposes like huntning which is why they're more obedient.
>>361732753
>Say one person doesn't make up for thousands
>"You know since one person accounts for everyone now"
Where is your reading comprehension?
>>361732526
There's 4.5 million dog bites every year in America alone.
>>361732905
Same about dogs. What's your point?
>>361732853
do not bully him
>>361731001
Oh look, its another autistic "cats are so shitty" meme thread
>>361732526
By far the worst analogy I've ever read
>>361731001
Nothing, not even money.
>Get older
>Christmas stops being about me & my sisters, it's for the grandchildren now
>Expected to buy gifts
>Can't because dumb faggot without a job
Wew lad I feel like killing myself.
>>361731129
>human acts totally normal
>starts to touch some box and instantly begins to lose his mind
>the way he handles the box, truly mad
>better attack him to snap him back into reality
reasonable to me.
>>361733046
>That guy with the cat carrier
He's optimistic, at least.
>>361732921
Except catfags are the one to right away go "CATS BETTER THAN DOGS HE DINT DO NUFFIN HE A GOOD CAT FUCK DOGS"
>>361732785
Cat, blue tongued skink, any kind of rodent if you like rodents.
>>361733027
Shit, it's probably bullshit but it made me laugh. Thanks Anon.
>>361731001
kek. manbaby got what he deserved, being so happy about something. I hate everything and I'm miserable all the time but seeing someone so unabashedly happy and immature get BTFO makes me happy (only ironically of course)
>>361732769
It's instinct for a cat to attack birds and vermin. You wouldn't have to do anything to make it so, it should naturally just do it.
I guess if you wanted to egg it on from an early age, you could get a mouse toy, since they have those, and teach it that way.
>>361732785
A guinea pig.
>>361733185
says the defensive dogfag.
>>361731624
you're not harusuke.
>tfw muslim
>tfw we only get baklava and sweets for bayram
Thanks Mohammed
>>361731001
I wanted to make some bad joke, but that guy is so happy to have a PS4, I decided I didn't want to ruin the moment
>>361731402
These are the kinds of injuries you get from an animal that isn't playing around, but actually wants to fuck your shit or kill you.
I bet he abuses the cat
Cats are retarded. More at 11
>>361733240
can you train them?
>>361732616
Cats brains don't work that way you dipshit. You probably gave it brain damage from abusing it.
>>361731636
>respect
being a literal beta and lowering your ears for thinking that the shitty human is an alpha isn't respect
cats are much more respectful by not taking shit from humans and being nice if you're nice towards them
>>361733037
I'm laughing at you right now lmao rekt
>>361731549
>Angry Birds
>>361732056
I think you consuming oxygen should be illegal.
>>361733027
good fucking lord. id pay money to see that
>>361733147
Just get them some candy you doofus, it's like $5 for a huge bag of it.
>>361731549
KNACK BABY
>>361733295
Wow we have DINDU cats now?
>>361733362
What the fuck is that thing
>>361733278
That sounds like a sweet Christmas to me :^)
>>361732706
>I'll disregard the point of the post to attack his method of refutation!
>And I'll type like an idiot and pretend to be him!
>That'll show how smart I am!
Jesus christ, stop posting
>>361731001
>white male
more like
>white baby
good god how this is proof of degeneracy
>but its good to be a manlet with a childs iq
we can only hope we self nuke soon and advance back as fast as japan
>>361732853
I agree chihuahuas are trash tier.
>>361732951
bad idea, they eat carpet, chew wires, and are generally terrible pets.
>>361733278
Please don't run people over with a truck.
>>361733414
it is a kekfish, progenitor to the lelfish
>>361731001
>straight for the jugular
Fuck cats.
Are cats just a roll of the dice in terms of temperament?
I don't really know what I did with my cat when I first got him, he's been around for about 10 years, but I spent a lot of time with him while he was a kitten. Now, he's super cuddly with me and has literally never hissed or scratched anyone. He just straight up fucking loves people, it's actually almost annoying sometimes because once you give him attention he'll just keep cuddling. Cats just seem like they're either complete faggots or the most cuddly shits on earth.
I'm just not sure if that's the way it is or if it's because of what I did with him while he was a kitten. Any catfags know the science behind it?
>>361732056
People use them for therapy, not realizing that actual therapy is cheaper and won't shit on your floor
>>361733328
They're nearly blind and deaf. They don't really do anything. He'll chill watching TV or vidya with you though.
>>361733405
OH YEAH YOU LIKE THAT KNACK BABY
>tfw you realize shigeru miyamato is a dogfag
Sony always wins baby
>>361731001
i asked all my relative to avoid giving me presents or i would lit a bonfire to burn their gift front of their eyes.
i like nothing so every year it was a variation of vesture/perfume/money.
i have no present and i feel happy.
best christmas ever.
>>361733378
>just get them candy
>on Christmas
I'd rather get no gift from him than some cheapout shit.
>>361731001
>Cat is typical PCuck who can't stand to see someone enjoy a console
>>361733328
No, they're really fucking dumb. If you want rodents with a bit of a brain, you should get a rat or certain breeds of mice.
>>361733295
it's fun to strangle then until they pass out
>all these furries
>>361732793
>you were the problem
Nope, new year, we fucking drinking champagne and laughing, the cat instantly starts to behave like the cat in this webm.
We instantly get calm because it was ready to jump at us, it was first time something like this happened.
After all whenever I was laughing with my sister loudly we needed to watch out for cat.
My cats never did those kind of jump attack because I knew cats well enough to know about this possibility.
Those neighbour getting scratched I used as example wasnt my cat, it was her.
I know cats do this shit simply because I observed it on multiple occasions, its something cats do when they near people who laugh or scream or behave hysterically.
What amazes me the most is that they attack their owners, in either of those attacks the owner tried to do something to a cat, the cat attacked without reason.
>>361733508
>nearly blind and deaf
Then whats the point. Also side note that sounds sad.
>>361732056
lmfao
you fucking autist
>>361733492
Eh, it's not uncommon. What breed is he?
>>361733561
I think a kid would be more disappointed getting no candy on christmas than cheap candy. Just get a $15 giant chocolate Santa
>>361731001
thats some strong killer instincts in that cat. you can see it has the DNA from tigers or some shit like that. went right to the neck.
>>361733598
>scalie
You're even worse.
>>361733598
>scaly
kys
My normie christfag friend bought me CoD: Infinite Warfare. I have not played any CoD before but I'm going to play this one just because it was nice of him to buy it for me and the space parts look kinda neat.
Not expecting much else, just something from my mum who I'm visiting tomorrow for dinner and then whatever my roommate got me.
>>361731402
I seriously hope he goes to the hospital or he is going to die. Cat bites have flesh eating bacteria. I lost part of my left hand from a cat bite.
>>361731549
>only a couple of those are exclusive
>>361733635
I believe he's a Bombay. Jet black everywhere, slight brown undercoat when the light hits it, and green eyes.
>>361731549
Count how many "Edition" games you see
>>361733240
Do not listen to him guinea pigs are cute and make cute noises but they are also walking shit machines the shit 24/7 the shit so much that it isn't even funny they are indeed the little lord of shit, they should be renamed guinea shit.
but yes they do make some extremely cute noises.
>>361733676
Post pics
>>361733553
I wonder what colossal level of social retardation one has to have to do something like this.
>If a dog did this it would get put down
>It's okay for a cat to do this
Why are cats so fucking retarded.
>>361733598
Can lizards show compassion and truly bond with humans?
>>361731283
He was probably over exagerating, showing that he was really excited. just having fun with loved ones
>>361731001
cat is one of us
he knows ps4/sony have been shilled like crazy since they shat at the xbone marketing team some years ago
>>361733492
Fairly certain it has (Just like humans) a great deal to do with how you are with it as you're raising it. my experiences have been the exact same as yours, nothing but really sweet, cuddly cats that are loyal and everything, raised from kittens, and I've never had a bad cat. I have met ONE bad cat, it belonged to a family member, and it was largely ignored when it was growing up, like they got it and played and cuddled with it a little, but most of the time just had it locked up in a single room alone. The cat was so fucking bipolar it was nuts, the poor guy.
>>361732760
>Cats are still predators and they will attack you
only extremely retarded cats attack humans and even then you can just laugh it off because it's a fucking cat not an animal that's an actual threat
>>361731821
this.. apart from 2 or 3 games.. thats a huge pile of wasted money.
>>361733328
Actually yeah, you can, maybe not as good as a dog but my guinea pig knows how to come when I call it and is always licking my hands or my cheeks when it is with me. I would say it is like a mix of a dog and a hamster with their behavior.
The only problem, if you can say that's a problem, is that they are very noisy, and if they want food or your attention they will make sure you know it.
>>361731001
Holy christ. Even the cat realizes the autist needs to be put down
Nothing and will never get anything.
Like every year, I don't even celebrate Christmas. Why bother?
>>361733448
shut up faggot
I wish ferrets didn't smell terrible. They seem like a cool small pet.
>>361732134
Cats aren't domesticated. http://www.smithsonianmag.com/smithsonian-institution/ask-smithsonian-are-cats-domesticated-180955111/
Cats and dogs are extremely different creatures. You have to behave differently with each of them. Cats don't like babies because babies are unpredictable, loud, and obnoxious. Dogs (properly treated) like everyone and everything.
>>361733598
>tfw you had a chameleon but it got bitten by a deadly spider and died
>tfw can't afford another lizard
feels fucking bad, man.
>>361732526
The difference is that you can't post an example of a black person doing something good.
>>361733486
>Being mad that a hunter follows it's instincts
Are ferrets good pets anons? Anyone have one? They look like they are comfy as fuck
>>361731402
thats why you trim your cats nails
>>361732906
Four I raised since they were kittens after some shitty stray decided to have them in my shed and abandon them. Two were strays I tamed. One is from a piece of shit family member that didn't want it anymore and was just going to take it to a shelter.
>>361733797
Well if you don't have anyone to celebrate it with then yes there's no reason to celebrate it.
>>361733508
>Guinea pig.
>blind and deaf
Are you sure you don't have a mole instead of a guinea pig? Guinea pigs have a much better hearing that humans, and they can see great, but their depth perception is bad because of how their eyes are located.
>>361731001
Damn. Straight for the throat. Cat is cold as ice.
>>361733907
Has anyone tested what happens if you keep it there forever
>>361731001
>dog
>pc
>cat
>nintendo
>human
>sony
>>361733747
No animal can ever "truly" bond with a human on the level other humans are capable of.
But some lizards like Iguana's and Tengu's are capable of the same type of "love" you would get from a dog
>>361733598
Mammals are closer to us and relatable. Reptiles are assholes. They have no feelings, they lay eggs, sex is only a means to an end. Pathetic creatures really.
>>361731402
>haircut
looks like the cat did us all a favor desu
>>361733867
They smell. Like real fucking bad, even when operated. Besides that they seem nice.
>>361731549
>at least two FIFAs
>at least two Maddens
>countless PS3 titles
>Monopoly Family Fun Pack
>Angry Birds
>Minecraft
>Terraria
bruh
>>361733027
do rabbits actually get jealous or care about that though
>>361733797
Stop being a grinch, just decorate your house and gift yourself something nice.
>>361733696
>This is a smart cat who loves to play and will thrive with a family who is willing to teach him tricks, play games with him and provide him with plenty of interactive toys.
>The lively and affectionate Bombay loves people and is adaptable to many different environments and lifestyles.
That's normal, senpai.
>>361733773
They will if you do retarded shit.
>because it's a fucking cat not an animal that's an actual threat
You'd be surprised.
>>361733492
Personally I've found that it's how you treat them. If you treat them as one of the family, feed it in the same room you eat, give it a bed where you spend a lot of time etc they're real good but if you just feed it and barely give it any affection it'll just turn out aggro
>>361733907
>tried this on my two cats
>didn't work either time
I think it's just a Hollywood stunt cat that has been trained to act that way.
>>361732785
Rats. They are like tiny little dogs.
>>361733907
Can someone explain to me why putting that thing on the cat's neck basically stops it from doing anything?
>>361733571
The pet will always be as dumb as the owner.
>>361734028
Most animals have most human expression. Even jealousy and cuckoldry.
>>361733410
We always have. Why do you think that black cats are a sign of ill omen?
>>361734009
god damn that is one cynical scientist
gamers + cats = magic
>>361733615
I grew up with several cats. Had friends over all the time, running around acting like stupid kids tend to act, laughing, doing everything you seem to believe triggers murder instincts in all cats. Never once had a single incident with any of them getting violent.
Stop sexually abusing the cats you find yourself around and maybe you won't be dealing with death tornadoes.
>>361731001
is that guy autistic? why is he jumping around like a 4 year old
Even when my cat is doing his most aggressive play attacks me he never breaks my skin/uses his claws. I think that cat just really doesn't like his owner.
>>361733747
Not sure about compassion, but certain kinds can develop a fixation on individual people.
>>361733907
why tho? is that how cats are trained?
>>361733676
>>361733717
Seconded.
>>361733995
How bad of an idea is it to catch a "wild" iguana? I know they're invasive to Florida and is probably a released pet or offspring from a released pet. There's a medium size green iguana I've seen around a few times. It's way too fast to catch by hand.
>>361734094
Cats have severe mommy issues.
>>361734078
Might only work on females. The male cat bites to tell them to calm the fuck down he's going in.
>>361734094
supposedly mimics the mama cat's grab from when they were kittens and instinct tells them to go limp so she can carry them
>>361734127
as much as i hate roasties cats are fucking retarded assholes
ill fucking kill the thing if it ever attacks me
>>361734162
it's just an instinct kittens have, they "deactivate" if they are held by the scruff of the neck since that is where their mother bites in order to carry them
>>361731549
That is one impressive pile of Bloodborne you have there.
>>361734162
Cats don't need training.
They have instinctually ingrained traits, such as the neck scruff paralysis and burying turds in the sand.
>>361734234
Kill yourself.
>>361734094
I believe that because the mother normally cares the kitten like that, they've evolved to basically stop moving and make it easier for her to carry. Though I'm not 100% sure and never actually looked this up.
>>361734162
Mother cats carry their kittens around by the scruff of the neck. It's instinct for them to basically just go limp when there is pressure applied to that spot in a fashion similar to that of the mother's jaws.
>>361731402
That's why you should stop hugging your animal like it's a fucking teddy bear. You deserve everything you got for being a fucking retard.
>>361734094
That's how mothers carry their kitten, by grabbing them by the nape, so the cat instinct is to just stop and get carried.
>>361731129
Dumb cat poster
>>361731624
OWOharusuke is great desu
>>361733928
retard
>>361734127
>avoids eye contact
>super annoyed
>hey you know what would be a great idea? Let's touch him!
Amazing
>>361734094
It's how felines carry around their kittens, even lions do it. Makes them go limp so they're easy to move around.
>>361733957
I would have a literal ton of cats if I could. I have two, best part of my days is coming home to them. They manage to both sit on my lap, even though they are in constant precarious balance and fall down sometimes.
>>361733832
we have been domesticating cats for like 5 thousand years, they may not be as domesticated as dogs but you can't just change the definition of the word
also dogs don't like everything, they still have prey drive and fears
>>361732087
Dogcucks eternally BTFO
>>361733598
wtf he should be dead already doesn't he know thats a komodo dragon
>>361734081
Are rats good pets? I wouldn't mind having one but every time I think about rats it reminds me of that webm of a rat brain in a robot moving around expressing fear and pain but the doctors don't kill it for science.
>>361733492
Cats have different personalities but they mainly depend on two things
Their contact with other cats and how they've been treated by humans. Most cat owners feed them garbage tier food and make them fat while never playing with them. My cat is a bit of a dick but since I raised her well she never scratches furniture/drapes and cuddles if she's in the mood
>>361734275
Dude, that's the same guy from OP, that's what the cat did to him.
>>361734254
>all that copies of bloodborne
I don't get it, why sonyggers want so many copies of the same game?
>>361734127
Is her fucking eyes start flowing out when she pull the lid down?
>>361734234
>ill fucking kill the thing if it ever attacks me
You wont, you agro a cat it will hunt you and it will fucking tear you apart.
You wont be even able to approach it since it will jump several meters at you and go for your face.
>>361734397
Rats are supposed to be pretty intelligent and pretty good pets, but they die in a few years.
>>361733928
>>361734275
It's not his Cat retards
>>361734017
Still better than 90% of steam accounts.
>>361734217
If you want it to be loyal to you you have to raise it from a egg basically and get it acquainted with your scent and prescence.
>>361734234
she literally grabbed her cat to try to to show it off to Twitch chat and got fucked up for it
people need to stop personifying these animals,,treating them like stupid teddy bears and remember that they're still fucking animals with claws,teeth and a instinct
>>361734397
please post that webm.
Also yeah they're pretty chill.
>>361734234
>roasties
Go back to your containment site you genetic failure.
>>361734009
whoever made this assumed humans will outlast radiation resistant insects and microbes
>>361733741
>I wonder what colossal level of social retardation one has to have to do something like this.
i'm a wizard, my man. A neet like me is not worthy of anything. i helped them struggling no longer with my convincing arguments.
they listened to me and took my warning seriously enough. that's like the greatest gift i would expect.
>>361734494
>die in a few years
Nah, I'll pass.
>>361732134
Those cats move like dark souls enemies, what the fuck?
in this thread
people comparing dogs to cats.
they are two worlds appart. and you need to diferenciate that.
you dont actually raise or educate a cat. you just get him used to have you around.
learn to respect his space, dont be mean to him and he will do the same.
they need their space.. so learn to leave him alone when he wants to be left alone contemplating the universe or whatever he likes to do when he decided thats hes going to be looking at the void for 30mins... its his thing.. leave him alone.
they are also much more basic than dogs, they react more to natural instincts than to actual orders. learn to manipulate them in that way, by knowing him better.
when he wants to cuddle or get petted he will get to you, dont harass him all the time trying to pet him when you want it.
cats are pretty cool, you just gotta learn to know them.
>>361734397
pretty solid pets, a little messy and loud and only live like 4 years but for how simple they are to take care of compared to a cat/dog they are worth it
I'd still take something like a bearded dragon/blue tongue skink/leopard gecko over a rat if I wanted a personable low maintenance pet.
>>361734397
No
Had two for about a year
All they did was sleep and shit all day
>>361734397
Rats can be super smart and loving, but the biggest downside is that they only live for a few years. They are also very social and have attachment issues, so get two rats if you do get them. Otherwise, they are low maintenance and easy to take care of. The only real annoyance is that it's pretty hard to toilet train them and often pee on you a little bit if they're too excited.
>>361734414
oh
still it's not the cat's fault that a retard went full retard and the cat responded in a rational way.
>>361734413
It's kinda strange that you mention food, my cat grew up alongside a dog and refuses to eat cat food for some reason. He's been eating dog food since he was a kitten, I kinda wonder how much influence being a around a dog has on a kitten. Cats really aren't an animal that would follow a different species by example, would it?
>>361732237
I genuinely enjoy the company of both cats and dogs
>>361734049
>Stop being a grinch
Looks like someone's gonna getJURY DUTY
>>361734397
Skip the rat, get a couple chinchillas. The most baller of the small animal world. Pic related, it's one of mine, she's 12 years old and still a bundle of fun. Sadly her non-biological sister died last year.
>>361733492
>temperament
Somewhat, but environment has an effect on their personality just like it does with people. They have personalities but you can temper them if they're raised properly. Just don't be an asshole to them when they're young and they'll generally be decent to you.
We have two cats we raised since they were less than a month old, treated them more or less identically, always cuddled lots and played and fed and so on. One of them now fucking loves cuddles and if you pick her up and put her on your lap she'll just sit there forever and purr, but the other one doesn't like being held for long and gets squirmy if you hold her for more than five seconds. Squirmy one is also way less affectionate & noisy when she's in heat than the cuddly one.
She's still a nice cat, never acts aggressively or anything, but she's definitely more subdued than her sister. It's actually been pretty neat to see their personalities develop as they grow.
My old neighbors had a family of cats, mom + pop with 3 kittens, and one kitten that grew up to be an absolutely giant cat (bigger even than his fatass father) but was the most skittish cat I've ever met. Everything scared him, even his owners just opening the front door of their house.
>>361734078
It's an instinctual thing, but it differs in intensity from cat to cat, and training plays a role as well.
http://pets.thenest.com/kittens-act-paralyzed-picked-up-scruff-8028.html
>>361731393
you ever seen a Chihuahua? They look like that when excited.
>>361731402
>had cat
>never did anything even remotely to that
You're a shitty owner. Cats are based.
>>361734115
buts practically already in effect
>people kill rats,roaches and other "vermin" or "pest"
>meanwhile breed genetical abominations like dogs
We wont histate to stomp on a rat or kill a opossum but killing a hamster is practically a crime (animal cruelty laws are such a joke)
>>361732056
They give us shutins the human affection and contact we need, without as much bullshit attached
>>361734397
Never had a rat but I hear they are pretty nice pets and smart animals in general.
>>361733492my gf'scat is a fat piece of shit that bites everyone.
I keep telling her to portion it's meals but it won't stop screeching and fucking meowing until it gets more.
They got a kitten months back and now it's getting bigger (not fatter because it's active).
Every time fat cunt cat plays up the new one bully's it until she hides, pretty gewd
>>361734626
>12 years
Holy shit that's a long time for a little thing like that.
>>361734525
It's much less painful to see him die compared to a dog that's been in your family for fifteen years or more.
But yeah I understand.
>>361734626
Besides the fact that they shit EVERYWHERE i agree they are great. I have one as well.
>>361731335
Except those weren't his pets. Also that cat fucked him up good, he had to get stitches.
>>361734262
>>361734454
>>361734480
>>361734508
when I still lived with my folks, my little sister found a stray cat and took it home. It would attack her when I wasnt around.
One day I walked in on it gnawing and swiping at her face and she was just taking it like a little cuck so I grabbed the cat and literally beat the living hell out of it. Literally picked up the cat and threw punches at it. It struggled at first but eventually it stopped moving and just let me hit it because it knew it couldnt do anything. My little sister cried and when she told our mom what I did she praised me because she hated the thing too.
>>361734714
They can live up to 20 years, though that is pretty rare. 10 - 15 is average.
some ps3 games from psn sale
hacked my wii u
new clothes
beer
money from grandma
I want to buy a Yui figure tbqh
>>361734597
They are.
https://www.youtube.com/watch?v=aP3gzee1cps
https://www.youtube.com/watch?v=WQITX5wH7NI
They learn by example.
>>361732237
They've begun to act like the dogs they own and bark like crazy when they see something they don't like. Faggots who contribute to consolewar threads are dogfags. Barneyfag was probably a dogfag. North Koreans are dogfags. Hitler was a dogfag.
>>361734597
I don't think they know what a species is when they're young. They definitely learn by following example though, usually it's the mother cat that shows her kittens how to use the litter box for example. I can totally see a kitten "raised" by a dog behaving like a dog to some degree.
Fuck dogs, man. I was biking to work once and some nigger left their Rottie out unleashed, and it just fucking sprinted at me and got my leg. Had to literally screech and stab it with random debris to get it off.
>>361734520
They should give you and themselves the greatest gift of all and burn the house down with you in it and collect insurance.
>>361734760
>punching animals
Kill yourself.
>>361734742
kinda funny
>>361734734
Yeah they're crap factories, but it's easy enough to clean up.
>>361734574
Yeah, I had some rats but they really don't live for too long, which kinda sucks since they're pretty cute and smart and you get attached to them.
>>361734127
>cat wagging his tail like crazy, clearly indicating he's irritated to anybody who's competent enough to own a cat
>and while the cat's doing that, she approaches her face
yeah no, either she's fucking dumb or she doesn't know about cats. i don't care if her cat was like a sweet cuddly puppy before that, if you see your cat doing that shit, you DO NOT touch it under any circumstances until it's calmed down or it's going to slash your shit 100%.
i don't know how people could blame the cat, he didn't start shit, she did. i'm not completely devoid of empathy for her because 1) that hurts 2) she got lucky she didn't get blinded, but if your pet has teeth, claws, or anythign that it could use to hurt you, then it's fucking obvious that you should learn about what it does when it's being angry so that you can avoid getting your eye gouged.
>>361731001
>have had two cats for years
>never attack me
cat is probably abused
>>361734640
bullshit I have a chihuahua and the fucking jump and start spinning when they are very happy.
Mugi
>>361732078sauce?
I don't really understand cats.
There's this friendly neighborhood cat that comes around and I feed her, and she jumps on my lap or on my desk and sits on my hands. But while I'm petting her she just randomly switches to crazy mode and gets aggressive, and then when I stop patting her she gets aggressive too.
>>361731549
>Rabbids Invasion - The Interactive TV show
kek
>>361734112
Because people were Superstitious retards that believed in witches and demons?
>>361732526
>>361734494
I don't have the webm but I found the video.
Rat brain in a robot
Not for the faint of heart
https://youtu.be/1QPiF4-iu6g
>>361732056
>there's always the chance that they'll attack you
this is how I know you have never had a dog. Unless you actively abuse your dog it would never attack you out of the blue.
>>361734852
youre right
I should have just killed the fucking thing
>>361731549
>These replies
This is how you know /v/ has been dead for a long, long time.
>have an orange tabby many years ago
>cat used to chase me down the hallway and attack me, full claws and everything.
>fight him back, bite his neck as a kid
cat respects me from that moment on, licks my hair clean attacks anyone who comes close to me. Brings me bats, moths, lizards, birds while I sleep.
>become best buddies, he occasionally play bites and I do the same
>grow older, move away
>acquire GF number 6 at the time, invite her back to my parents, didn't feel like dealing with roomates and parents were away.
>get a blowjob, cat jumps up swats GF in face
>laugh historically
>eventually settle down with GF get a call from mom years later, cat can't be found ran away
deep in my heart I know he went looking for me, feelsbadman.
>>361733492
Vet here, cats develop pretty much their entire outlook of humans in the first 10~ weeks of their life, if they experienced any hardships or mistreatment(even if unintentional) from a person they are going to carry that with them for life and it almost never changes, like if you keep it indoors all the time during this time it will almost certainly just stay inside sleeping most of the time as it gets older etc. works the opposite way too, if they are outside all the time they will only ever really return to eat and sleep. Dogs develop over time throughout their life and change based on what they are taught over time. Dogs can recover from trauma, cats, unfortunately do not seem to.
This is what makes some cats fucking dickheads, the ones you buy that are a few years old have a history that defines them and often leads to people doing things with the cat that it is not comfortable with, thinking that cats generally just like that. For example, scratching their belly, you can tell when a cat has been raised around people and was around them constantly when it lets you do this without trying to bite or scratch you, because it knows that a human touch isnt malicious, animals do not like being touched on their undercarriage unless they were handled by people from a young age.
>>361731001
>starts waving the box around like a neanderthal with a haunch of meat
Why's everyone a manchild nowadays?
>not getting an Argentine Tegu, the dog of the reptile world
>>361734972
people killed by domestic cats ever worldwide: 0
people killed every year by domestic dogs in the US alone: 20-30
>>361734760
good
things that arent on the same level of sentience as humans should garner no sympathy or special treatment
animals are just a tool to be used the same as timber or water.
Nature has no emotion. Nature is not our friend. Nature is not our rival. Nature is simply a means to an end.
>even animals are aware of how shit the PS4 is
Why does /v/ think cats are so dangerous?
>>361734924
Cute cat anon.
>Raising pets
People actually spend thousands a year on creatures who do literally nothing but eat and shit.
>B-but they make me happy!
So do video games.
>>361732619
no animal loves you, they don't have that human emotion
>>361734948
Overstumulation.
>>361735003
Thats interesting but also kinda creepy.
>>361732753
>COLONIZATION WAS HORRIBLE
>ARMIES OF WHITE PEOPLE, INVADING OUR... NOTHING
>SETTING UP SCHOOLS, HOSPITALS, PLUMBING, ENERGY GRIDS
Are niggers the most cucked race?
>>361734948
you didn't check you petting privilege and the cat got triggered.
A common mistake for cat beginners.
>>361735038
I have a 14 year old tokay gecko that's pretty damn cool, tegus seem like a lot of work to care for.
>>361735004
There's 4.5 million dog bites every year in America. Stop being retarded.
>>361732134
Looks more like those cats want to play.
I've seen my cat in aggressive mode and in play mode
>>361734948
over stimulation aggression
Cats build up static through their fur and get annoyed. Pet its head/chin a few times then call it quits unless it wants to headbutt you
they just want to chill near you
>>361734851
kek, let's wait for next christmas.
>>361734850
Rotties can be aggressive as fuck if not properly trained. I was walking to school years ago and a lady screamed at me to "kill it", then I realised a pit bull was biting a labradors face off. The owner of the lab was some fruit who was frozen. I can't really blame him that pit bull looked fucking deranged. I got told to kick it but I was worried it would rip his face clean off, this 70 year old guy comes up without hesitation and takes his old man sweater off, and proceeds to choke it the fuck out.
I hid the dog and it's owner in someones backyard, so much fucking blood.
The owners of the pit bull came out, disgusting rednecks. Proceeded to hit the pit bull with a stick while it was passed out, obviously beat it a lot.
Some people treat their animals in such a sickening way it's sad.
>>361734760
>Being this forceful with strayts
You never fucking pick up a stray and force it into your home unless it's a little kitten. That's not how animals work.
>Beating animals
Also entirely fucking retarded. Regardless of what it was doing to your dumbass sister, it does nothing but allow you to vent your bullshit out on a living breathing thing that's doing nothing but trusting it's own instincts, confused as fuck because WHAT THE FUCK IS IT DOING IN THAT HOUSE.
Whatever the fuck is with your gene pool, I have no idea, but somebody has to ensure that shit doesn't continue to spread.
>>361735143
Love is not a real emotion.
What happened to PS3 has no games?
>>361734948
I heard it's building up friction or some shit. You basically just have to pet but don't pet for too long (or too hard), especially in the same area.
Also if the cat is sat down it usually isn't asking to be petted. Usually they'll be on all fours to have their back stroked or rolling around for their stomach (If the cat is the sort who doesn't mind having their stomach touched).
>>361732785
As >>361734081
Get a rat, very clever animals, try and get a young one from a breeder and play with it often, they can be the nicest pet you'll ever have if like me, you are stuck in a small flat etc.
I've always had them in pairs, always males, just need to stay on top of cleaning as their cages can get quite dirty and make sure you read up on them and do all your research before getting one as they are prone to certain things that can be easily avoided with a bit of knowledge ahead.
Alternatively, gerbils, they can be damn mental, in a good way, and very clean animals.
>>361731818
It is your fault. Pets should never get fat if their owner isn't retarded and actually feeds the animal a controlled portion during feeding time.
>>361735120
That cat looks like steve buscemi
>>361735125
Thanks
>>361734948
you pet her some place she didn't like anon
try only petting the head next time, cats love that shit
>>361735137
Spend money on vidya, spend money on doggo, what's the difference when you agree that both can make you happy?Why not both?
>>361734948
Cats are pretty weird with that stuff. Most of the time in cases like that the cat wants attention but then ends up "overstimulated" since he's not really used to it and freaks out a bit.
I can't believe this thread is about cats and dogs and not the kid's retarded reaction.
If an animal ever attacks you or someone else then just fucking kill it. Anyone have that webm of some old guy getting mauled by a dog and the fucking retards who just stood there and watched and just one guy is trying to get the dog off of him?
>>361735209
come do it yourself edgelord
i bet you anything i can beat your ass easily
>>361734760
>oh yeah, you guys think I'm a miserable worthless piece of shit? well guess what. I'm a miserable worthless piece of shit >:)
What's your point?
>>361731001
>Manchild: "YAY, UNCHARTED 4!"
>Cat: "THAT'S NOT A VIDEO GAME, SONYFAGGOT!"
>>361732526
I think that one of the most important differences is that dog attacks are much more dangerous and on average with much worse consequences than a cat pushing a child.
And I'm an owner of both. Or was. My cat died few years ago and now I'm only with my dogo.
>>361735225
Do they bite? Post pics of rat
>>361735120
they're dumb
>>361735120
Autism prevents them from understanding cats social cues
>>361731341
Cats perceive excited body movements as aggressive
It's why people think cats hate dogs. They just see a dogs happiness as being aggressive
>>361733228
Someone put the ok hand and tears on this please
>>361733743
Well mostly because a dog will take off your entire fucking face when it gets like that. A cat will give you stitches but you'll fucking survive.
>>361734916
>watch video of a girlfriend attacking her boyfriend
>have had a girlfriend for two years
>never attacked me
girl was probably abused
>>361735221
>or rolling around for their stomach
I thought this too but when she was doing this and I went for a pat she scratched and bit me. I think she was baiting me.
>>361734760
Did mommy put some tendies in the oven for you to reward you for being a good boy and beating up the mean little kitty?
>>361735272
That's an adult. See the beard.
Monorail Cat
>>361731283
half of neo /v/ still live with their parents and act like this.
>>361734656
Pretty much.
What are your thoughts on ferrets anons? Are they good pets?
>>361734948
Certain cats are only okay if their owner does it.
>>361731001
>>361731402
This cat is a fucking hero, nobody else was going to do anything to stop this guy like acting like a gigantic faggot.
Maybe next time he starts spazing out like a retard he'll think twice.
>>361734760
edgelord incarnate
>>361732056
he is right you know
>>361735137
>Playing games
People actually spend thousands a year on games which do literally nothing but sit on your shelf/on your hard-drive and consume space.
>B-but they make me happy!
So do pets.
>>361731636
Dogs are just pussies around assertive cats
>>361732785
A rodent or a small bird
>>361734760
One time a stray cat entered my grandmother's house and killed two of our chicks.
It felt good to kick the little shit to death.
>>361731001
>Cat tries to murder the manchild
>Dog is a manchild itself so it does nothing
>>361735286
Spoken like a true inbred hick fuck that only knows to resort to hitting things with a balled up fist rather than using any inkling of rationale, as if that shit wasn't apparent enough with your reaction to that poor feral cat who was fine until your sister.
>>361735248
My two pussies are cute too.
>>361735214
The autism is strong with this one
Is this /edge/ general?
Hello my roaches
>>361735286
Yeah anon, obviously he is the edgelord here. Jesus fucking christ.
>Want to get a pet as a kid
>Family gets a dog but I'm allergic to it
>Go to friends house with a cat and I'm allergic to that as well
>Go to allergist later in life
>Find out I'm also allergic to Birds
>and horses
>and scales(?)
>Finally get an apartment and get my own pet. Choose rats because that wasn't listed on my allergy test.
>Also allergic to the rats
WHAT KIND OF CRUEL JOKE IS THIS
>>361735421
they smell
>>361731636
dog owner mentality, cats don't give a shit about their owners, they don't even perceive their owners as their master like beta dogs do.
>>361731405
>Can't even kill himself properly
God I love retard pepe
>>361735542
pet cats
>>361735150
>>361735185
>>361735221
>>361735267
>over-stimulation
https://www.sciencedaily.com/releases/2015/06/150602164024.htm
>cats are literally autistic
wew lad
No wonder you guys like them so much.
>>361735407
Crocodiles are stupid, literally old world reptiles who operate purely off instinct and have tiny brains
Flamingos are cunts like all large birds
Gorillas are demonstrated to approach retarded humans in terms of intellect and bear obvious superficial similarities to people as well (niggers)
>>361731001
>sperg out over a $300 paper weight
>cat knocks some sense into you
I hate the hairball puking hissing machines but that little shit is based.
>>361735261
>what's the difference
The money you spend.
And even if you somehow spend the same amount of money on games as you spend on raising a useless animal there at least won't be times where you have to drop what you're doing to take a game outside and pick up its shit.
>>361735580
Do you have one
>>361731001
>dog is excited and wants to see videogames
>cat is buttmad because no attention and attacks manchild
I know a person with a cat and that one is okay, but the rest of the cats I know are all decoration tier just like fish and come in the house to eat and fuck off outside
>>361735594
Finland does it again
>>361735538
spoken like a true numale who cant defend himself or his loved ones for fucking shit
my genes are the future, your genes are for raising my genes
thanks senpai
>>361735576
Get a plant
>>361735591
>cats don't give a shit about their owners
That's really not true. Cats are social animals, they aren't pack hunters but they do gather in groups even in the wild, not to hunt though.
>>361733295
I don't have a cat but if I did and it did anything even close to that to me I would beat the ever living shit out of it
>>361731001
Overly aggressive cat. My previous cat would have just looked curiously and then mind his own business. My current cat would have probably just run away. In no way was that cat attacking its owner over that normal. Deserves to just be left outside.
>>361735407
Because Alligators are a pest down in Florida.
The other two had names.
>>361733410
top kek
>>361735318
That's adorable. I love when cats ask to be pet like that.
>>361731001
I didn't ask for a PS$ because I didn't want to bother my mom and dad too much. They've been in and out of the hospital this year
>>361735631
This sort of overtstimulation also exists in other pets like dogs though.
>>361731001
The cat made the right call.
Get excited for pussy faggot.
I got a prostitute for Christmas. Santa and I dp'ed her.
Is this the /an/ thread in /v/?
viiiiiiiiiiddddddddeeeeeeeeeooooooooooooooooo gaaaaaaaaaaaaaaaaaaaaammmmmmmmmmmmeeeeeeeeeesssssssss
>>361735351
Unsocialized cats perceive excitement like that. Cats who grew up around kids or dogs don't.
>>361735576
Look into immunotherapy and allergen shots. I was allergic to dogs for most of my life, I went on a program for a few months, got a stronger shot of said allergens every week and now I'm no longer allergic to dogs.
R8 my doggo.
>>361735653
Nope, I was invited to a friend's house. Guy had a pair. They are really cute and extremely active, but they have a noticeable stench.
>>361735846
DELETE
THIS
At least it isn't the fucking audio version
>>361735120
>cat tongue
disgusting
kys cat fags
>>361732316
>No duplicates
>posters hung up by tape in the background
Doubt it. It's probably a completionist collector who is retarded enough to think doing it while the console is current is a good idea.
>>361735407
A lot of the uproar was because Harambe was an endangered animal. Alligators are not even close to being threatened.
>>361735318
This cat looks like it may love its owner, or at least really just like being around him. It's asking for pets, but not overly enthusiastically, like it's really just enjoying his company.
I want a cat like that.
>>361735903
Pug/10 get a better dog
video gaaaames???
>>361735903
Forcing your dog to be gay. BAKA senpai.
>>361735846
What literally happened here? Was this on purpose or a bomb training exercise gone wrong?
>>361735158
>civilization is automatically better than remaining native
>not admitting that both have thier pros and cons
nah mate
civilization is still just as barbaric as nativism
we're just REALLY good at hiding it.
Your view is completely one-sided and biased. The "gifts" of society and civilization are just as much of a ball and chain as they are a "gift"
>>361734938
miqo'te ffxiv
>>361735965
get a kitten from a breeder and raise him well
also get a boy cat they're more chill
boom you've got a loving bro cat who will hang out with you or sometimes fuck off to go sunbathe/sleep
>>361732550
Depends on the pet
>>361735846
Dog deserved this.
>>361735903
Very cute, pet him and tell him anon says hi.
>want to get a pet
>want to get a dog again
>realize that I'll outlive him, love him, and he'll die within 15 years
It's just not worth the pain. Is it okay to not own a pet because of this? The pain is too real. I remember losing my old dog and it hurt like a mofo
>>361732056
>I really don't understand why people get babies. All you're doing is wasting your money feeding them and taking care of them and cleaning up their shit and there's always the chance that they'll attack you because they're stupid animals. I think having children should be illegal
>>361733278
run over some frogs god damn kafir,allah bismillah,allahu ekber.
VIDEO GAMES!!!
>>361735934
i want to touch that tongue
Cats fucking suck
>>361736020
>civilization is automatically better than remaining native
Yes, in literally every scenario
If you disagree turn in that computer and go fight tigers in a loincloth
ITT: Animals are great, and can make great companions if you treat it right.
And in the event that the pet is not great, it is 90% of the time the fault of the person/people raising it or generally treating it right, but will proceed to ignore that and blame it on the animals and their species as a whole
That's the human race for you. What a lovely bunch.
>>361735985
go to /an/ if you want video games m8, we are discussing pets here.
>>361734626
They sound fucking awful.
https://www.youtube.com/watch?v=d57bXlSQXws
>>361731402
Literally pussy-whipped
>>361731283
Average autistic neofag / sonygger
>>361733747
They are as coldblooded as my ex. No compassion from them.
>>361735903
Man pugs are weird as hell which makes em funny as heck.
g-games??
>>361736048
>also get a boy cat they're more chill
My personal experience is exactly the opposite. I've had many cats and the girls always seem more intelligent and chill.
>>361736020
>t. AUUUAUAUUUUAAAUUUGGGG the Aboriginal
>>361732785
Just get a dog and take it on an hour long walk each day it's not that hard.
>>361731001
this is so hilarious video, laffing for minutes
>>361735903
He looks like a charming young lad
>>361736135
Go kill yourself, you vegan cunt.
>>361735846
I never really understood this
Was it intentional or an accident?
>>361735175
Those are either stupid/cruel owners or dogs biting stupid strangers. It's an objective fact that 99% of dogs would never, ever attack their owner unless the owner is complete shit. If you had any experience with them you'd know this.
>>361732657
Case in point
......................
games??. . ................
>cats a bro
>every other month or so he'll turn into a jackass for a few days
>carrying my keys and dropping them in the toilet
>knocking over my drinks
>biting my guests
What the hell man?
>>361736080
Babies carry your DNA and keep your lineage going after you die. Pets die before you.
>>361736108
They're neat. It's such a weird texture, pretty harmless on house cats.
Large cats like lions have REALLY rough tongues and if you somehow meet an affectionate one that wants to groom you, its tongue will actually scrub away your skin and make you bleed.
>>361736225
Hell be cramped in the apartment though, I want to get a golden retrever.
i don't understand how some people don't understand animals
i mean they're much simpler than us and yet many people find it hard to comprehend that they are not teddy bears who like to be man-handled. i have a relative who owns two cats, one who tolerates her man-handling, and the other who will first moan and then scratch her if she ever picks her up. and she picks the cats up in a way with no regard to comfort or how it feels on the cat's side of things. because it doesn't like her, she acts like the second cat is some fucking villain like a naughty child or something. she is such a fucking retard. in reality the cat just doesn't like having its stomach, a vulnerable zone (which she doesn't understand), being touched unwanted. and the second cat actually likes me because i know just to stroke its back and leave it alone.
>>361735286
>posts a story about beating a cat with a pic of king virgin cuck
>somehow the guy calling you a faggot is the edgelord
You really are braindead aren't you?
>>361736240
Dogs do attack though. They're much more vicious and dangerous than cats are.
>>361736197
i mean biologically female cats like to wander more while males are content to just hanging out with you for extended periods of time
this does depend on whether or not the male was neutered before going through puberty
Male cats that got neutered late are just straight up cunts
>>361733147
>Get them nothing
>niece still comes up to me and hugs me every time I leave my cave for more food
>>361736080
>Comparing a worthless dog to a human, the thing that built everything around you.
Not saying useful animals should be illegal, like dogs used for herding sheep. Just useless animals like most people have. They're just a danger to everyone around them and have no benefit.
>>361736063
He will live and die anyway anon. You might as well give him a good life and he'll give you company and good moments in return.
>>361731549
All those multiplats and bad movies.
I really don't understand. With all of the money you've spent on those games, you could have built yourself a PC to play those games in higher resolutions and at higher framerates.
there are grown men on this board who are receiving children's toys from mummy and daddy for christmas...
...lmao
>>361736279
birbs are cool, I'd get one if they didn't make such a mess. I hear they're more or less impossible to potty train.
>>361734626
What the fuck. If I brough one of those home my gf would literally die. It would be the end of her.
>>361731402
Where is this photo from? The vid was posted literally 3 hours ago. Is this faggo a /v/irgin?
GAMES
>>361735276
>if a goldfish attacks you, fucking kill it
>>361736279
What the fuck is happening?
>>361735421
I've had like ferrets for the last 7 years. They smell and take a lot of work.
BUT they are the best kind of hamster rat type pet.
They actually like to play with you and are fun unlike hamsters or anything else like them.
>>361736263
It's just a prank dude your cat has a sense of humor
>>361736298
OK catshitter, you've obviously never owned a dog. If a dog does attack with intent to kill/seriously hurt it can obviously do more damage than a cat but cats are much more likely to randomly give moderate scratches/bites than dogs. My dogs, my friends dogs, and my families dogs have never, ever shown even the slightest sign of aggression towards any people, least of all their owners.
>>361736439
It's baby died.
>>361736135
>It's not the criminals fault he attacked or killed someone, you just didn't treat him right
Have you ever thought the reason they attack is because they're a bunch of stupid animals who you can never comprehend?
>>361736292
hey
don't say sensible things here, this is a no sense zone. Let the retards continue being retarded.
quick dump more cats since we're going to page 10 soon
>>361736263
HE DINDU NUFFIN
>>361736360
Birds can be ultra aggressive when their habitat is fucked with/changed.
My friend had an African Grey that would completely destroy any toy that would be in her cage unless she's had it already for years, they basically do a test of: Put toy in cage, if bird starts destroying it, remove it, until they find a toy she likes and then she keeps it like a child for years and years.
>>361733278
Muslims have a December holiday?
>>361736240
Even if it is dogs biting strangers, how is that ok you retard. You think it's ok to attack strangers?
>>361735225
I've only ever been bitten by a Rat once, he was my first rat, from a rescue centre and the previous owners didn't look after it at all (christmas present for kid, then ditched when bored of it)
After that though, once he setlled he was perfectly fine, had him out multiple times each day, chewed all the buttons off my tv remote but he was a big lazy rat and used to spend half his time just chilling on me watching films, downside is they pee wherever they feel like it.
One bite so far and i've had about 12 rats all in all, all very friendly, Had a friend who had some albino rats though and I looked after them when he went on holiday and they were biters. From what I found out, they have poor eyesight so test everything with their teeth...never had any myself though, but I wasn't a fan.
My last couple of rats passed away a few months back but they were great critters.
Will hopefully get another couple soon, really miss having rats about, just gotta keep an eye on them if they are out and about, had to retproof everything as they love chewing through anything that looks important.
>>361736307
I recognize this /ss/
>>361736063
Get a Red-eared slider turtle I'm pretty sure that it will outlive you or at the very least die when you die.
>>361734760
Good job. Lolis > cats
>>361736483
I do own a dog, and I don't like him.
>>361736292
>the cat just doesn't like having its stomach, a vulnerable zone (which she doesn't understand), being touched unwanted
kek
my cat loves belly rubs. she goes fucking bonkers for that shit, she'll roll over on to her back at my feet and just stare at me like I've fucked up, until I lean down and rub her tummy and she starts rolling around and purring like an engine
bitch wouldn't last 5 minutes outside
>>361736048
>Get a kitten from a breeder
Or don't be a subhuman and adopt one from a shelter. My buddy and his girlfriend adopted a little kitten a year or so ago, and while they kind of spoiled him with toys and treats, he grew into one of the friendliest, most chill cats I've ever known. Pic related, I took this back in June or something while I was cat sitting while they were on vacation.
>>361735137
Are you retarded? Dogs do shitloads for people.
They were a working animal. Guard, shepherd, pulling your sleigh. And even stupid ass cats cought mice
>>361736582
>rat
>rescue center
Don't these fucking things live like a year?
>>361736483
>My anecdotal evidence is more important than the facts!
>parents have a cat before they have any children
>brother is a toddler and chases the cat
>cat accepts it at first and just runs away, climbs up on top of things, brother is a good climber and follows it though
>eventually the cat can't take it anymore and throws a punch at my brothers face
>knows not to use claws
>toddler brother is sad and stops
>sister is sleeping and a fire starts in her room
>cat runs from her room to the other side of the house up the stairs to my parents bedroom and start screeching and clawing at the door until my father comes out to see what's going on
>we're at my grandparents
>I'm the youngest and I'm a toddler
>sleeping in grandparents bed, cat sits next to me and guards me
>I wake up, whine and the rest of the family hears it through the baby monitor.
>father gets up to deal with it, bud grandpa says he wants to take care of it
>grandpa comes back and asks for help because the cat won't let him near me
>>361736641
>caught mice
Explain to me how catching mice isn't a great thing.
>>361736606
If you actually do you are probably an asshole to him. If you hate dogs so much why do you have one?
>>361731001
Good cat, saw a guy with shit taste and took action
>>361735313
See >>361736582
I replied to my own post like a retard, late night!
(truth is i'm waiting for the jolly fat fuck to break and enter my home so I can get him arrested)
>>361736636
The cat I adopted died from heart disease after I loved it for 3 years. Call me paranoid but not risking that again.
>>361735542
Gee Cindy, how come your dad lets you have two pussies?
>>361736740
It's not my dog, it's my sisters.
Don't like him either way, too energetic for me.
>>361736715
You a stupid
>>361731402
> rips cat off
how you expect that nigga gona react?
>>361736864
>too energetic for me.
I see. You're a low energy catfag.
>>361736130
You live longer but for what?
To lose your mind to the point of losing your ability to be self sufficient?To lose basic motor skills? To become (barely)walking breathing fine china?
Living for the sake of living is hardly "living".
>t-then go and be a hermit then if you dont like it!"
Addiction to technology and comforts prevent you and me both from that and you know it. much like the man in the cave there's no way you can "go back" now that you've left.
Besides If civilization was so great you wouldn't hear so many stories of people actively choosing to forfeit it with suicide.
You look at the native on national geographic and laugh at how "un-evolved" he is
But ask yourself if you he looks like hes in any more pain than you are?https://www.youtube.com/watch?v=WZUUIe3A6Y0
Just want to chime in about people's misconception on small dogs, specifically chihuahuas.
They're not all yappy faggots with attitudes. Pic related is my little dude I've had since a couple months old. Nothing but unconditional love and companionship. Knows all the cool tricks and is well socialized with other dogs. He's not fixed but also isn't sexually aggressive towards people or other dogs either.
The previous owner was some 16 year old girl who locked it in a cage 15 hours a day and just fed it fast food and never played with it. Wasn't even trained to be on a leash or wear a collar.
It breaks my heart that 90% of the people I talk to have had bad experiences because people are shitty owners. They're social animals. Get them some exercise and show them some love, they're not with us for long.
>>361736652
I've had rats live for around 3 years usually, but they generally only live about 2 or 3 avoiding any health conditions, which are quite common with rats but treatable if caught early.
I was surprised, don't get many rats in the rescue centre near me, but there it was, this is why people should never by small animals for kids, motivated by christmas or birthdays unless you know full well it won't just be forgotten about shortly after the novelty wears off.
>>361736142
She's overprotective as fuck, they aren't as delicate as she makes them out to be. I've had my chin for 12 years and she's going strong.
>>361731001
RKO!!!!
>>361736949
Yes, life was truly better before vaccines, shelter and toilet paper
Go away you literal nigger
>>361736945
There's nothing wrong with being a catfag.
Thread is about to get autosaged happy xmas my m8.
>>361736996
why
>>361736292
>neighbor talks whole sentences at her dog when it doesnt do something she wants, like it actually understands the words shes saying and she tries to make a whole narrative for the dog to understand why it should do something like "come inside" or "stop barking" and would lock it outside when it didnt comply, and then start shouting abuse like "fine have it your way dumbass" as she walks into the house
>Ive known someone who owned a cat and would constantly grab it while its sleeping to carry it around and pet, but it would start scratching and biting him while he says "shhhh calm down, calm down" while it is kicking to break free and screeching. He then went on to get 3 more fucking cats and he did the same thing with all of them, trying to surround himself with them at times and they would try to get away
>>361736271
Parrots can live for like 80 years. Most people end up passing them on in their will. Not all pets are made equal.
>>361732785
1 male mouse or 2 or more female mice. I had 2 female mice and they were incredibly entertaining. What a shame they got skin cancer so i had to put them down.
>>361735846
>>361735927
>>361736014
>>361736054
>>361736239
http://www.liveleak.com/view?i=483_1427898354
I still haven't seen a dog trained to shit in a toilet like a cat can be trained to do.
Do you believe specific coat colorations act a specific way? Do you believe Western games will ever get catgirls right?
>>361731549
you're whats wrong with gaming, developers make any old shit because they know there are fags out there like you who will buy it. have some fucking standards you chode
>>361737086
At least he's using the crossing point, smart croc.
>>361736289
Yeah Golden's need a lot of room to run around. I had two of them in high school, and we lived on 2 3/4 acres and they used every inch of that to run around like retards. Top tier dogs if you've got the room for them though, I miss wrestling with them.
>>361736698
Cats are magical.
When I was a toddler my grandparents had a mule, I would ride on it sometimes. The cat learned to do the same. She would just hop on and let the mule take her around.
The mule was pretty old and eventually she disappeared, they told me she went to the circus. I was happy for her, I imagined she had an act there and people cheered on her. Only much later did I learn they literally sold her as meat for the lions.
I didn't even go to my grandmother's funeral.
>>361737164
>sheep wants his son to have a peaceful nap, but the crows keep cawing
>tfw I rescued a batch of kittens barely a week old abandoned in the dumpster at my work, bottle feeding them and teaching them to poop
We found homes for 4 and kept 2. They're turning 6 this year.they grow up so fast.
>>361736032I mean the artist
>>361737304
why didn't you go to your grandmother's funeral though
>>361736830
Went to a shelter to get one and couldn't resist both of them.
>>361737304
>valuing a mule over your family members
good thing you wont breed
>>361737086
looks like kermit
>>361736392
Die from the cute?
>>361737317
you're a good man anon
I hope you and your kittys have a good life
And this is why the next day that cat is going to wake up surrounded by cucumbers
>My best bro cat is already nine years old
He's going to live to be like 30... right?
>>361731001
man fuck dogs
>dogs walk off my neighbors property and onto mine and harasses the lawn guy i hired
>break a branch over its head and its owner sees this and flies into a rage that i did this
what did he mean by this? if he didn't want me to break a tree branch over his dog's head he shouldn't have let it wander onto my property
>>361737304
Mule got to spend the last of its old life as sustenance for the life of another, pretty good way to go desu
>>361736428
Maru is the king of cats
>>361737452
No from fear. This looks like that midget rat man from Scare Tactics
>>361737452
Rat guy here, never had a Chinchilla but always wondered what they are like as pets, are they generally quite friendly animals ?
>>361734127
When I had a cat as a young lad, I would play with it the same way as a dog. Lightly push it around, grab tail, etc. Then go back to petting him. Most he would do was scratch up my hands and arms. Never ever full on attacked me like that.
If I remember right, if he was really pissed off, he'd get low to the ground and kinda make a growling sound. Then i'd just leave him alone until he cooled down.
Putting your face right up in front of a cat at any time seems pretty dumb.
>>361736960
My mom has a Chihuahua, he's pretty dope. He's an old man now and she spoils the fuck out of him, but he's not an asshole like a lot of people think they all are.
>>361737391
Because I was pissed she fed my best friend mule to lions.It was actually for other reasons but I don't want to blog.
>>361737438
I loved that mule.
>>361737564
It was still pretty sad when I found out. They way the described it (put her alive inside the lion's cage) like it was funny didn't sit well with me.
>>361737079
people who have never known the comforts that we know through technology now have lived "happier" lives than us.
Utopia's are an unobtainable, subjective idea.
stop pretending like you're innately and automatically better than another person because you have access to more materials and resources than him.
>>361737509
NANI
>>361735081
People like you are legitimate threats to the safety of others
It's still Christmas Eve
>>361736867
what the fuck are they eating ?
>>361737624
>Scare tactics
Holy shit I haven't thought about that in years.
>>361737767
I dont buy it, especially since you have undoubtedly never lived the way you praise
>>361737803
>tiny hand with opposable thumb
Some kind of monkey, from the look of it.
Why are Chihuahuas so horrible? Most aggressive dog breed I have ever seen
>>361737495
I can't take all of the credit. my GF (now wife) did the bulk of the bottle feeding, and I did the bulk of the covering my head with pillows annoyed because they were crying in the middle of the night while she bottle fed them.
>>361737813
>>361737452
What small dogs are comfy as fuck to have
>>361736867
Why do birds of prey look so fucking mean?
Just looks like a killing machine.
>>361731283
This post exemplifies autism.
>>361737651
Yeah, they're really friendly as long as you socialize them when they're little. She loves to sit in people's laps, and if I'm laying on my bed she'll come chill on my shoulder or sit on my back.
>>361737797
no, it's 2pm Christmas day
>>361737510
I like dogs, but am always a bit careful around them.
When I was a kid, we were getting a dog, greyhound, from a rescue centre.
The person came with the dog to walk it around the nearby area with my mum, to get it used to us, I bumped into them on the way to school and the dog was friendly as anything.
Needless to say I couldn't wait to get home, so school finished, got home, opened the door and bam, the thing came running out of the kitchen and dived on me with its teeth out, snarling like mad, went for my throat, luckily my stepdad was home and dragged it off me and out into the back garden.
It tore through two doors over the night to try and get back to me, was taken away the next day.
Most memorable "shit my pants moment" I can remember.
Do love dogs, just always a bit wary of them, no idea what its background history was though, could have been badly abused by previous owners.
>>361738061
4pm
>>361737794
If a human found a small abandoned bear cub in nature he would often take it in as his own.
now ask yourself what would happen in the inverse of the situation?
Do you think if other animals had the ability to sculpt the world to the extent that we can(like ants or beavers) they wouldnt for our sake? Do you think animals have "morals"?
wake up
>>361737723
How did that cat not shit itself
How are pugs and pitbulls, my German Shepard died a month back and I need something to fill the void.
>keep expecting to hear the sound of dog feet walking on my wooden floor when I come home and feel the presence of the dog lying on the bed behind me when Im on my computer, only to reach a hand back to stroke something that isnt there.
>>361737943
Because women buy them at treat them like fashion accessories instead of living creatures. Any dog will be a piece of shit growing up not being trained or socialized in any way.
>>361738007
They are descended from fucking dinosaurs.
>>361738063
do you like cats though is the better question
How many people ITT go
>he deserved it for having shittaste XDDDD
is fucking cringeworthy. This place is really full of full blown manchildren.
>>361736279
Oh no, that's terrible.
It looks so distraught. I wish there was sound so I could hear Its mourning cry :(
>>361738226
shit get another german shepard.
You can't go back from wine to mud water
don't threads like this one awaken something in you guys? a desire to beat a cat to death, or to throw a dog off a skyscraper
>>361738095
>animals have no morals
>therefore I should have no morals
>>361738253
Nah it's funny. He acted like a child and got hurt
>>361738095
None of this changes the fact you're trying to normalize your own sociopathic personality
You are a freak and a dangerous one. Hopefully you don't murder some person and try to rationalize it
>>361738007
Probably because they are killing machines.
>>361738253
Sorry we insulted your favorite movie player
>>361737723
Reading about how cats survive such high falls was pretty interesting.
>>361738316
It awakens in me the desire to strap you to the train tracks.
http://www.liveleak.com/view?i=84d_1375775788
>>361738316
No, I am not a fucking serial killer
>>361734654
This. My cat has never even sort of harm me, the most aggressive thing she has ever done is paw at me when I'm not making with the belly rubs.
The retard sperged out hard out of nowhere, poor thing was terrified, even the dog was like "wtf."
Cat was all like "Alright Tugboat, this is what we always talked about, what we planned for, the man-thing is now a zombie, run while I hold the line. Don't turn back, no matter what you hear."
Although, it's worth mentioning I'm an xbro, maybe kittehs just don't like Sony products.
>>361738383
>>361738436
Miserabel edgy cunts.
>>361738316
I have a desire to train cats to kill