let's face it, Darwin's theory of evolution is nothing

>>1131063
>this is why I am a Catholic stalinist now
pretty sure stalin didn't like christianity :^)

Marx agreed pretty much with Darwin though, they even shared letters with each other.
And Catholicism isn't exactly the right sect if you want to oppose evolution, try with something form the US south.

>>1131077
Marx never took on Darwin directly iirc, though their theories are similar in that struggle is the driving force of history, or in Darwin's belief, natural history

>>1131063
its not a coincidence that Darwin formulated his insights just as harsher poor laws than ever before were being formed by Whigs (his party) in the late 1830s in the name of malthusianism population pressures. Moreover, the late 1830s to late 40s saw the rise of the Chartist labor movement that threatened bourgeois society and property of which Darwin was a part

>>1131063
Holy shit marxists were attacking science from the beginning

>>1131126
to be fair though, almost immediately after Darwin published his ideas they immediately became an ideological justification for all sorts of ideas across the political spectrum. In other words, the theory isn't necessarily as "scientific" as it is today, especially considering that Darwin's theory has undergone some modification since the 19th century

lol not an argument fagget k thanks kill yourself the pope fucks kids spread the word like he spread my asshole

>>1131153
To be clear, Darwin was not a scientist, and only had a degree in Theology.

>>1131167
We know that already, every opponent of him will bring that up.

>>1131167
it was literally the only degree you could get from cambridge at the time. he also really only did the degree because he wanted to follow in the steps of several famous anglican-naturalist deacons in the past. becoming a clergyman was well known as a comfy job that gave you tons of free time for one's own pursuits and it paid well. On top of that, Darwin came from an unorthodox family. His father was an open free-thinker who doubted god and his mother was a unitarian and so Darwin never bought into the trinity aspect of Christianity. Darwin's grandfather Erasmus Darwin was also a well known, if controversial, naturalist who elaborated on Lamark's theories

>>1131175
So you admit evolutionism is a religion.

>>1131167
And Mendel was a monk what is your fucking point.

>>1131223
The world would have been much better had he never been born.

>>1131230
Mendel did not manufacture two generations of atheists. And Mendel was a scientist.

File: 1462297511826.png (188KB, 400x400px) Image search: [Google]

188KB, 400x400px

>>1131229
What?

>>1131167
What does it even matter?
It's not like most modern theologians have accepted his theory.

>>1131223
>it was literally the only degree you could get from cambridge at the time.

This is literally false, as there has always been degrees in Applied Mathematics at Cambridge.

>>1131236
Evolutionism = Darwinian religion.

>>1131243
And no sane scientists either.

File: 1462844566577.png (79KB, 500x500px) Image search: [Google]

79KB, 500x500px

Preach it, comrade.

File: Screen Shot 2016-05-13 at 6.26.36 PM.png (210KB, 775x873px) Image search: [Google]

210KB, 775x873px

>>1131244
woops i misread this

>>1131248
Then almost all biologists must be insane

>>1131252
That group of Christians failed, hard. Paul ran around getting donations for them, because they all went broke.

Nobody told them to try socialism; they tried it and found out that it doesn't work. Just like the pilgrims did.

>>1131246
Evolution is a scientific theory, not a religion.

>>1131259

Correct. Seeing that DNA, one strand, holds 600,000 bits of information in it and saying there is nobody who coded it is quite mad.

"A bioengineer and geneticist at Harvard’s Wyss Institute have successfully stored 5.5 petabits of data — around 700 terabytes — in a single gram of DNA, smashing the previous DNA data density record by a thousand times."

>>1131264
They did not fail, they had God's love.

But the kingdom of God is now, friend. A classless society is possible.

>>1131235
>Mendel was a scientist

Mendel conducted scientific experiments. Made scientific observations. Postulated scientific theories. Published said theories in scientific media for peer review.

Just like Charles Darwin.

>>1131266
It's a false religion. There's nothing scientific about it at all; nobody has ever observed, tested, or repeated any macro-evolutionary change, ever.

You have to take it on faith that sufficient time (another lie) allows all micro changes to become macro changes.

>>1131277
It is not.

Jesus is the King, and a Monarchist of the highest order, as well as a High Priest of the highest order.

There will be people who rule and reign with Him; there will be people who serve Him; and there will be peoples subject to Him.

>>1131282
>Completely unlike Charles Darwin.

>>1131283
>It is a false religion
It is not a religion.
>You have to take it on faith
You don't. Gradual changes lead to big changes. Adding one to thirteen for a long time will get you one million.

>>1131283
what about the fossil record? comparative anatomy? resemblance of two species' DNA?

>>1131285
>muh imperial fanfic turning jesus into a roman shill

>>1131276
And some of Human DNA codes for functioning tails, why would that be there if we were created like this?

>>1131290
>Gradual changes lead to big changes.

Have you ever observed this?

>>1131293
All micro evolution.

The Cambrian explosion is explained perfectly by the creation of the world by God a few thousand years ago.

There is no Darwinian explanation for the sudden appearance of fully formed life all over the planet.

File: family_nicholas_ii_of_russia_ca._1914.jpg (3MB, 4295x3221px) Image search: [Google]

3MB, 4295x3221px

>>1131285
We are all subject to him, and none is equal to him.

Monarchists and charlatans may try to trick the people by making idols of themselves, but their falsehoods will be razed bare before the Lord. As was the fate of so many tyrants before them.

>>1131295
It doesn't. You just think it does.

>>1131296
Yes, I have observed small changes leading to big changes.

>>1131296
Yes. It's all there in the fossil record.

>>1131300
Yup.

>>1131076
Stalin had no qualms with religion. To him, it was a tool of control and command.

Lenin now.

>>1131303
Like what?

>>1131301
>It doesn't.
It does

>>1131304
Yes, from the flood. Fully formed creatures with zero transitional fossils showing one kind of animal turning into a different kind of animal.

>>1131309
Show me the DNA sequence for human tails.

>>1131298
Except the Cambrian explosion is not observed to have happened a few thousand years ago.

>>1131276
Just because you believe in evolution does not make you an atheist.

>>1131301
Which is why Humans are sometimes born with tails?
Also, quite a big part of our DNA is junk DNA, shouldn't it all be functioning if it was put there with a purpose?

>>1131298
Maybe, just like Creatonism can't explain the Fauna of Australia or that Sheetas show illnesses from being inbreed since thousands of years while most other animals don't- According to the flood they all should.

>>1131314
It is observed to all be in the same layer of dried mud that came from the Flood, that you think are gradually accruing layers of the earth's crust for some reason.

>>1131307
Me, becoming an adult.

>>1131315
It helps.

File: c8IDKpz.jpg (305KB, 1296x971px) Image search: [Google]

305KB, 1296x971px

No joke though, are Marxists actually so autistic as to call eachother 'comrade' in real life? I've seen that a few times here and there, and it's akin the kind of shit you'll see at furry cons. If you people actually do that, I'm glad that you all look like pic related and will likely never reproduce.

>>1131298
What about the ediacaran organisms that pre-date the cambrian.

>>1131316
There is no junk DNA. You need to catch up with your memes. There was DNA that was thought to be junk DNA that was found to have purpose.

If you found a programmed computer, you would assume someone built the computer and programmed it.

But you find yourself, an infinitely more complex programmed computer, and you believe people who tell you that your ancestors were monkeys, and that your real ancestors were star dust.

All so that you can not be responsible to God.

>>1131318
Human to human.

Give me a macro change.

>>1131315
True.

Though it does reduce the role of God to a God-of-the Gaps.

File: 1883d6jlb7tb0jpg.jpg (32KB, 636x358px) Image search: [Google]

32KB, 636x358px

>>1131312
Here's a result of it.

>>1131317
You just did a circular argument.
The Bible story is true because the Cambrigian explosion is false, and the explosion is false because the bible is true.

>>1131310
There's no evidence for a Biblical Flood. The fossil evidence, rather, indicates long gradual changes over long periods of time.

http://youtube.com/watch?v=IBHEsEshhLs

https://www.youtube.com/watch?v=63LRfLyR-JU
What do you think about this?

>>1131325
>There is no junk DNA. You need to catch up with your memes. There was DNA that was thought to be junk DNA that was found to have purpose.
yes, it does have a purpose. but it is still "junk DNA" since it goes unused in the production of proteins

@1131287

No (You) for you

>>1131323
They look like bitchin' things God made at the bottom of the ocean.

I do not subscribe to your "each layer is a million years" nonsense, so to me, you cannot use this false geological column to date anything.

>>1131332
The bible story is true.

The cambrian explosion can be best understood by subscribing to the creation story in the bible, and not to millions of years of "evolution".

I didn't say no babies had tails; I said show me the DNA you claimed was coded for human tails.

File: zz1 (2).jpg (102KB, 840x600px) Image search: [Google]

102KB, 840x600px

>all the people talking about DNA in this thread
Everyone who isn't a dumbass knows that DNA is a hoax by the marble earth atheists. They made DNA up to drive people away from God, just like they made the spherical earth up.

>>1131325
There is junk DNA. Some DNA

There is a biochemical role for some non-coding DNA to perform, but much of it is still superfluous junk, and can be excised from the genome while the organism continues to function and reproduce, completely unaffected.

>>1131335
Evidence is all over the earth. Literally. Sedimentary rock is dried mud in mudslide layers.

Look up the columns formed by the explosion of Mt. St. Helen's in the 1980's. It created massive cliffs with many layers just like the grand canyon, in months. Drying mudslides.

Those layers were formed horizontally, not on top of each other gradually (which makes zero sense).

>>1131341
The Encode project, a scientific collaboration involving researchers from more than 30 countries, has revealed that large swathes of the human genome previously thought to be useless, and termed 'junk DNA', in fact play a crucial role in regulating the manufacture of proteins in the body. The discovery could revolutionise the understanding and treatment of hundreds of diseases.

>>1131344
That's the result of that DNA, how else do they get those tails?

>>1131347
>>1131350

>>1131338
>scientist knows nothing about the Bible

Actually atheists tend to know a lot more about the Bible than creationists.

>>1131344
The Cambrian explosion happened 540,000,000 years ago.

>>1131343
You can use things inside the layers to date them - magnetics, fossils, etc.

>>1131351
DNA is just a parts list. It's not the schematics.

>>1131355
Bullshit. Literally impossible.

1 Corinthians 2:14 But the natural man does not receive the things of the Spirit of God, for they are foolishness to him; nor can he know them, because they are spiritually discerned.

>>1131356
4500 years ago.

>>1131346
please be a real flat earther please be a real flat earther

File: fedoration.png (120KB, 301x315px) Image search: [Google]

120KB, 301x315px

>>1131283

>>1131358
Worst circular reasoning ever. A complete fraud.

>>1131354
Right. Like I said, some junk DNA has a purpose, even if it's non-coding.

Except what you're ignoring is that large swaths of non-coding DNA is still plain, regular, useless junk DNA.

>>1131363
540,000,000 years ago.

>>1131359
Then what else do make them to grow tales, if they lack the DNA needed to develop them?

>>1131369
It is not. Things you don't understand still have reasons and purposes for being. You're just ignorant of them.

What part of "crucial role" do you not understand?

Where do you faggots come from? This board's anti-science bias is incredibly frustrating sometimes.Darwin pretty much spent decades looking at birds and other animals, documenting exhaustively his findings and coming to a similar conclusion to another noted naturalist. This does not sound like the actions of someone who just invented his theory because it was socially acceptable. His ideas, whilst modified in light of new evidence, sometimes debunked and occasionally discarded over time, have generally held up. He made testable predictions that actually turned out true over time. Unlike a certain Mr Marx.

His findings met a lot of controversy at the time and were not accepted which kind of blows your retarded theory out of the water.

Because his ideas were adopted by racists, communists and fascists doesn't de-legitimise them in any way.

>>1131371
Maybe 4600 years ago. About the same time as the oldest known tree on earth.

>>1131372
Find that out, win Nobel Prize.

DNA is just a parts list. Protein machines in the cell read it and make proteins.

>>1131376
I missed where Darwin saw a bird turn into a fish.

>>1131362
45% of surveyed Christians believed that Sodom and Gomorrah were a married couple.

>>1131346
you got the meme of the israeli astronaut shooting the american one in space cause he realizes the earth is flat? someone pls psot

>>1131377
540,000,000 years ago.

>>1131375
I understand the crucial role.

Read the statements again. Some junk DNA has a crucial role.

That doesn't mean all DNA has a crucial role.

>>1131364
Oh look, it's a cocksure and passive aggessive atheist. I've never seen that before.

File: 63ae8463d381cd5d6b894ff4b5b3cb85.jpg (8KB, 236x177px) Image search: [Google]

8KB, 236x177px

>>1131384
Literally Westboro-tier response.

>>1131386
Are we posting words at random now?

>>1131387
It's on another (more appropriate) board.

>>>17688532

>>1131390
I'll go 4648, but that's it.

>>1131384
this desu. if evolution, as that anon says, were true... then a rock would have turned into a monkey by now rofl

>>1131394
So it's not fucking "junk", you autistic moron.

/rel/igion board please.

wWhy do creationists have to exist? Are you people at least American? I don't want to think this is a global problem (even though it somewhat is)

>>1131387
https://www.youtube.com/watch?v=qDdFlhzNq8o
Wjatch this.Educate yourself.

>>1131402
Not even close. 542,000,000.

>>1131412
Was that the dude doin' a deadspin 100000 feet up?

>>1131396
It is a real flat earther! nah, just impressed that I ran into a flat earther on /his/. statistically you were more likely to be a troll

>>1131404
Some of it is, some of it isn't.

It's why you can get rid of it and the organism is unaffected.

>>1131411
We evolved from lower apes. Some of us still act like it.

>>1131204

How is this circular reasoning?

>>1131417
not that guy, but there are a lot of us around senpai. stick around long enough and maybe you'll start to question what the indoctrination mills (the school system) has taught you

>>1131063
>Marxists attack facts and logic

I see nothing has changed.

>>1131386
>45% of surveyed Christians in the USA.

This is crucial in terms of nearly all religious discussion on this board. You won't find many Christians in Europe who believe that the bible was literal or that evolution is "just a theory"

I only ever found "edgy atheist" memery once I browsed 4chan. In my country there are no issues between religion and science. Maybe there's something about American thinking that encourages black and white thinking about everything.

>race relations
>politics
>religion and science

>>1131417
https://www.youtube.com/watch?v=JoHoFhIxpXc

>>1131381
Those proteins are also used to make the cell produce other things, like fats, oils and other important things.
DNA also decides our appearence, like skin and hair color, as well as how the body will be shaped.
If the DNA decides our hair color, how long and sort we will be and stuff, why wouldn't decide our body parts and how they will be shaped?

>>1131409
Aren't /his/ and /pol/ the religious containment boards or am I missing something?
>He who controls history
>Until the last priest is strangled with the entrails of the last pol...

>>1131362
>>1131386

You are both retarded.

>>1131426
Please don't start a school near me.

>>1131167
...and he practiced science...

>>1131444
Utter waste of quads

>>1131416
No, it's the truth. 3:09

>>1131425

meant

>>1131368

>>1131426
>but there are a lot of us around senpai.
uh sure. that's why Jeranism gets only a few thousand views at most on his videos

>>1131451
nice singles lol

>>1131442
No boards should have to be sacrificed to contain something. Boards should be created if there's clearly a demand for it. Hence /mlp/.

>>1131465
There was never a demand for /mlp/.

/co/ worked just fine. /mlp/ was created because people kept bitching to Moot about people posting ponies on their /b/.

>>1131458
I watch those videos out of sheer incredulity.

Hard to tell how many of his viewers really believe.

>>1131310
Fossiles are single frames in a very complex movie whose plot we are trying to figure out

>>1131277
>a classless society is possible

Yes, we can all live together in harmony in a globalist, socialist paradise, with no prejudices, where everyone gets along perfect :^)

>>1131384
i missed when I saw a jew turn into god

>>1131442
Nah, it's just getting close to summer and the kiddies are getting excited. The christcucks abandoned /lit/ for /his/ a while ago. When school comes back, they'll probably go back to their boring lives again. I promise.

File: qD3tjl9.png (61KB, 1224x1137px) Image search: [Google]

61KB, 1224x1137px

>>1131483
Yes

>>1131483
That is our endgame yes. We're still in like act 4 of 300

The theory of evolution has been debunked years ago.

It's a myth, a fairy tale.

It's the religion/worldview of atheists.

>animals that are adapted to their environment are more likely to produce more offspring

How can you not acknowledge that natural selection is a real process?

>>1131533
Why do you want that, though?

>>1131063
> let's face it, Darwin's theory of evolution is nothing more than a justification of mid-victorian social structure.

If such was the case then the theory of Social Darwinism would have come about much earlier.

> "Muh animals are adaptive machines"

Are you implying animals don't try to adapt to the environments they're in for the good of their survival?

>>1131415
4648. Final offer.

>>1131419
Holy crap.

"This DNA is junk because it does nothing."

"Oh, wait, this DNA that we said was junk has a crucial role in the regulation of proteins."

Anon: It's still junk DNA. *bangs head on wall, rocking slightly forwards*

File: 1440502622041.jpg (71KB, 503x581px) Image search: [Google]

71KB, 503x581px

>>1131063
>Catholic stalinist
PURGE!!!!

>>1131589
>DNA exists
see >>1131346

>>1131422
That's a lie from the pit of hell.

>>1131441
It's just a parts list. Nobody has found the plans yet.

>>1131589
Anon, there's non-coding DNA. There's a lot of it. Some of it does things. Some of it does nothing but take up space. There's lot and lots of DNA.

>>1131449
He did not. He postulated things that happened in the past, and he was wrong about those things.

>>1131555
It'd be comfy as fuck.

>>1131455
Geologist: "This layer of rock is 10,000,000 years old because it has a 10,000,000 year old trilobite in it."

Zoologist: "This trilobite is 10,000,000 years old because we found it in a 10,000,000 year old rock strata".

>>1131482

Book was better. Read the book.

>>1131605
Would it though?

None that wanna explain why we got such a difference wild life in Australia?
Also, explain why God created Dodos, who went extinct in the moment humans and other predators made contact with them.

>>1131511
I see why you missed it; God turned into a Jew.

>>1131600
All coded by God. So you'll never fully understand it, ever.

File: Tho’ Nature, red in tooth and claw with ravine, shriek’d against his creed.jpg (118KB, 700x520px) Image search: [Google]

118KB, 700x520px

>>1131548
>How can you not acknowledge that natural selection is a real process?

Because it's such a terrifying idea to contemplate.

File: Dating_JC_full_1.jpg (98KB, 720x960px) Image search: [Google]

98KB, 720x960px

>>1131607
But that's not true.

File: ANswer.png (3MB, 500x5655px) Image search: [Google]

3MB, 500x5655px

>>1131625

>>1131625
I kekd

>>1131632
>keking at Creationists
You don't happen to be a liberal Muslim homosexual ACLU lawyer professor and abortion doctor

>>1131611
Yeah.

What more is there to being comfy than taking it easy, and having everyone else behave likewie?

>>1131651
I am. AMA

>>1131619
god is the supreme coder desu

File: rock-08.png (746KB, 1219x874px) Image search: [Google]

746KB, 1219x874px

>>1131668
Well, if the earth is 4,6 billion years old and evolution is real as you say, why isn't this rock an animal now?

>>1131677
Oh, but it is. Look closer.

>>1131596
This is a very sad understanding of genetics.

>>1131698
You need to catch up. Your understanding of DNA is ancient history. Like 10 years back.

>>1131623
Devil rocks planted by the devil hisself!

File: 1038_08.gif (70KB, 462x239px) Image search: [Google]

70KB, 462x239px

>>1131707
True

>>1131623
I do not share your faith in radiometric dating.

Radiometric dating, specifically Argon, dated igneous rocks formed at the explosion of Mt. St. Helen's to be 3,000,000 years old.

It happened in the 1980's.

They can't get a known sample anywhere near correct; I have no faith in them getting an unknown sample anywhere near correct.

The fact that you pick your test to get an older date or a younger date should be a huge clue it's bogus.

It's funny because the geologic column points towards a global flood.

>clams are at the bottom because they can't run
>birds are at the top because they are the last ones to drown
>humans are next, because they seek high places before drowning

Then there are whale fossils in deserts, clams in mountains..

Evolutionists believe each layer represents a different era, which is false because trees are found standing upright between multiple layers.

>>1131730
And those layers are bent at 90 degree angles in places, and those layers are dated oldest on top and youngest on the bottom in places, and those layers have absolutely no burrowing holes in them whatsoever.....the list just goes on and on and on.

>>1131730
And stalactites can be formed in days or weeks.

Yet evolutiontards say they are formed through millions of years.

>>1131607
>use some other data like minerals to date the layer with some fossils
>do this with many different layers
>whenever we test rocks with some species x in them, it always turns out that they are from a very narrow time range
>x can't be found in any other rocks than those from this very narrow time range
>if we find x in a rock, we can deduce that this rock comes from that period of time when x lived

>>1131746
That's actually heavily dependent on the sort of minerals the stalactites are made up of. Some form faster, some form slower.

>>1131283
http://news.nationalgeographic.com/news/2008/04/080421-lizard-evolution.html

http://humanorigins.si.edu/evidence/genetics/ancient-dna-and-neanderthals/interbreeding

yes

>>1131727
The man that did those tests admitted they weren't pure though.
>Inthetrashitgoes.JPG

File: Nephilim.jpg (128KB, 668x531px) Image search: [Google]

128KB, 668x531px

>>1131816

>>1131826
Interesting, anywhere I may see exhibitions of those skeletons?

File: rabbit_0.jpg (44KB, 620x463px) Image search: [Google]

44KB, 620x463px

Please, explain to me how the Flood works with Australian wild life.
This little fucker is the biggest threat against Australian wild life up to date, why wouldn't Mammals just out rival all the marsupial if they all came off a boat somewhere in Armenia?

>>1131835
The government doesn't want you to believe in the Bible, do you really think they would release these bones to the public?

Satan wants you to eat the Darwinian narrative.

File: 1462495638051.gif (94KB, 325x244px) Image search: [Google]

94KB, 325x244px

>>1131861
>The government doesn't want you to believe in the Bible

>>1131665
>>1131533
>>1131522
I remember being an idealist 14yo with no real concept of reality too.

>>1131870
>Bible outlawed from school
>Evolution forced to be taught to kids

>Creationists are silenced and ridiculed

>Degeneracy in Hollywood and music industry to push people away from biblical values

>abortion
>feminism
>transvestites
>homosexuals

do you live under a rock or something?

>>1131861
yeah yeah sure. source this shit and how we could see and verify the bones for ourselves

>>1131861
So you don't have any evidence for it?

>>1131881
>Bible outlawed from school
It isn't, teachers aren't allowed to use it in their education though. Students are allowed to bring them.

>Evolution forced to be taught to kids
True

>Creationists are silenced and ridiculed
Not by the state but by others.

>abortion
>feminism
>transvestites
>homosexuals
None of those related to creationism but personal freedom.

>>1131892
Go visit the Smithsonian basement

>>1131918
>>1131923
>>1131925
They could just as well have been Aliens, we got just as many reasons to believe that as if they were Nephs

>>1131925
I'm like 90% sure the lines disappear with age.

>>1131934
So where are the bones?

>>1131940
In the dirt.

>>1131955
And bones I can see for myself?

>>1131934
>>1131925
still no source. in this day and age this can easily be photoshopped

>>1131960
They don't want you to see them.

>>1131706
I'm not claiming to be incredibly educated, but I graduated with a biochem undergrad last year. If it is outdated already, must have had a poor education them :(

>>1131914
do you personally have access to the Smithsonian basement?

ITT: atheists pretending there is no agenda going on

>>1131963
But they want me to see pictures of the bones?

>>1131973
If the governemnt got all this proof for why Evolution is false and Genesis is right, why would they try to keep it away from us?

>>1131727
>any type of testing if done wrong, or given a bad sample, or used to date something it was not made for, will give bad results,

But when used properly, and retested again and again it gives consistent results that can be collaborated

File: nephilim-01.jpg (746KB, 920x577px) Image search: [Google]

746KB, 920x577px

>>1131974
They are leaked images, or taken by curious tourists after it was recently excavated.

The vast majority of giant skeletons are not photographed, and quickly covered up.

Because it hurts the Darwinian narrative and completely destroys the theory of evolution, and proves the Bible is true.

>>1131826
Convinient that those look like the same skeleton scaled up to different sizes

>>1131979
Illuminati nigger.

Freemasons and occult societies control the world and they literally worship Lucifer/Satan.

>>1131988
So they know they will go to hell for it, but they do it anyway?
Why?
They will burn for all eternity for it.

>>1131918
>>1131925
You can change the shape of a head by putting wooden plates to it's sides and wrapping it tightly with cloth while the baby is still young and leaving it there for months/years

>>1131982
>They are leaked images
you have yet to prove this. posting them without a source or any way to verify them and then wanting to be taken seriously is absurd

>>1131982
Any reason they couldn't smuggle with themselves any bones or skulls?

And is this proof Neil degrasse Tyson created Earth?

File: 1457636616661.jpg (26KB, 249x249px) Image search: [Google]

26KB, 249x249px

>>1131063
>this is why I am a Catholic stalinist now
>207 replies
never change /his/

>>1131998
that looks pretty fucking photoshopped fampai

File: humboldt lake.jpg (12KB, 260x248px) Image search: [Google]

12KB, 260x248px

“There were giants in the earth in those days; and also after that, when the sons of God came in unto the daughters of men, and they bare children to them, the same became mighty men which were of old, men of renown.” Genesis 6:4

“And there we saw the giants, the sons of Anak, which come of the giants: and we were in our own sight as grasshoppers, and so we were in their sight.” Numbers 13:33

File: BSM creastes earth.png (3MB, 1920x1080px) Image search: [Google]

3MB, 1920x1080px

>>1132016

>>1132018
>29 posters
>everyone here has posted at least 10 times
>alternatively, there's one colossal samefag samefagging +100 times

>>1131982
>WAKE ME UP

>>1132027
>alternatively, there's one colossal samefag samefagging +100 times
hmm... is OP also the flat earther and the nephillim poster?

>>1132046
op here, nope

File: 1458314848540.jpg (34KB, 540x298px) Image search: [Google]

34KB, 540x298px

>/his/ trying to /bio/
>/rel/ trying to /bio/

oh boy

>>1132060
any board trying to talk about anything besides anime

>>1131076
On his death bed - he was scared and begged the Orthodox church to pray for him - my grandparents still remember when the whole churches in Romania ( we were communist of course ) prayed for him.

>>1132510
source this shit. sounds like utter rubbish just like the story that was invented that Darwin renounced evolution on his death bed and became christian again

>>1131264
They survived until today as monastic life - the developed model with all its earthly implementation are present at mount Athos - watch a documentary or something.

>>1131877

It isn't hard to remember yesterday

Ok then. Darwin's theory isn't taken as the be-all, and end-all of evolution. One example that springs to mind is Kropotkin's, which focused on intra-species cooperation being a major driving force of evolution. As I recall, it was even recently granted some traction.

>>1133448

>intra-species cooperation

Do you mean interspecific? I'm not familiar with kroptkin, but commensalism and mutualism have been know for a long time. But it's not likely to have been the major driving force of evolution in general, there are several species where it is a very significant factor though.

>>1133448
>>1133458
my bad, intraspecific makes sense, do you mean ants, termites, mole rats etc?

>>1133458
Kropotkin would have been writing in the late 19th or early 20th century, and no I'm not sure on the specific terms, just that he was called a crackpot for the theory and that it was recently somewhat vindicated.

As an aside (since you're not familiar with the man) Kropotkin was a zoologist and anarchist theorist known mostly for being the foundational theorist of anarcho-communism, based on his observations of primate social structures.

This thread shows that Dawkins is in fact needed.

>>1133465
>>1133458
Kropotkin focused attention on the fact that the main driving force of competition isn't against other species, but against the universe as it is. Lack of energy kills a lot more than predation. So it's not just outright mutualism that he's talking about, but that competition between species is a (relatively speaking) rare mechanism that's developed in response to this baseline pressure.

>>1131290
>Gradual changes lead to big changes.

But not fast enough, practical evolution relies on sudden mutations for much of its significant change.

>>1133475
>the main driving force of competition isn't against other species, but against the universe as it is. Lack of energy kills a lot more than predation.

But competition against the universe would be shared by life in general, while competition with your own and other species is a very significant factor in most environments, it's not rare, and many species are distinct from one another due to their niche not overlapping with other species.

>against the universe as it is
>developed in response to this baseline pressure.

I guess this is right, no competition for resources, no need for competition (but this would eventually occur due to limited resources and larger population sizes).

>>1131429
>This is crucial in terms of nearly all religious discussion on this board. You won't find many Christians in Europe who believe that the bible was literal or that evolution is "just a theory"

European orthodox Christian here.

I believe the bible events literally happened - I would negate my own dogma otherwise.

Actually all those events explain lots of stuff.

>>1131076
He was a fucking priest

>>1131861
Dude there were no giant humans in the bible... why are you cultists so retarded?

+ The huge skeleton thinghie it's an internet hoax.

>>1131063
All you have proven is that Engels didn't understand Darwins theory of evolution. And neither do you.

>>1133536
Confirmed for never having read the Bible.

>>1131167
Being a scientist isn't limited to the degree you have.
Also a Humanities degree is holy on /his/

>>1133542
Damn you are stupid. Confirmed stupid.
Taking events from bible literally is ok - but taking translated structures as you understand them literally is plain retarded - next thing you tell me is that from your understanding sons of God that came down to women in Genesis were aliens or fallen angels...

>>1133554
They were. This is what was widely taught and believed.

The Book of Enoch and Jasher confirms it aswell.

>>1132519
5 march 1953

Guess check from orthodox countries the liturgy from that day, check radios and newspapers - here in Romania it was direct order from government to all churches to ring the bells 3 times / day and for everyone to gather and pray for Stalin, under his direct order on death bed.

>>1133555
They were what? You're just a cultist that lost his mind in the ocean of scriptures.
It's sad that you spread your bullshit and some people fall for it...

>>1131306
Yes he did.

>>1131335
The cretaceous layer is the only layer which shows up on each continent and it could only happen under water.

>>1131386
>of a test group of 1000

>>1131582
I'll take your offer. Show me.

>>1133595
Not by a global massexctintion?
Also, arent dinosaurs almost always the only things found there? Shouldn't mammals be there too in case of flood?

>>1131980
Just because you can get a material to give you consistent date times doesn't mean they are correct in the first place.

>>1133614
~95% of all fossils are shallow marine organisms, such as corals and shellfish.
~95% of the remaining 5% are algae and plants.
~95% of the remaining 0.25% are invertebrates, including insects.
The remaining 0.0125% are vertebrates, mostly fish. (95% of land vertebrates consist of less than one bone, and 95% of mammal fossils are from the Ice Age

The flood was a global extinction event.

>>1131596
>No one has found the schematics

You're an idiot.
Look up what Hox genes are because those are a significant component of these schematics that you claim we "Can't find".

>>1133651
I don't really see how any of that proves your point.
Evolutionist scientists have already came up with an explanation for that, that the continents used to be below the seas before they were pushed up above ground by movement near the center of the earth.

If the Flood theory is true we should find far less marine fossils at the continent, as almost all of those have never been below the sea level apart from during the flood, the marine life not gonna have any time to that massively reach past the population of land animals during just the few years the flood lasted.

>>1131982
Explain why whenever something big and new in science was discovered in recent history, it wasn't covered up.

>>1131077

why would you need to share letters with someone who lived in the same city as you

>>1133915
I dunno, seems like they did anyway.
http://friendsofdarwin.com/articles/marx/

>>1133595
>The cretaceous layer is the only layer which shows up on each continent

what

>>1131167
And Jesus was only a carpenter ;^^^^^)

>>1134010
Jesus was God in the flesh.

>>1134010
A stonemason would be a more accurate translation of Tekton

>>1131982
http://creation.com/arguments-we-think-creationists-should-not-use

File: 1433596508344.jpg (105KB, 460x288px) Image search: [Google]

105KB, 460x288px

>>1134017
No he wasn't. There is no evidence to support this claim.

File: 1433685368467.jpg (6KB, 145x145px) Image search: [Google]

6KB, 145x145px

>>1131982
>>all of the modern scientific establishment is involved in a massive conspiracy that for some reason can only be discovered by random cretinist websites on the internet.

Seek psychological help.

>>1131276

>argument from complexity

literally the only people who use this argument are people who don't understand the most basic aspects of evolution

>>1131326

Single cell to multi-million cell sentient organism

Yeah ok, totally not a macro change

>>1131730

This argument is fucking retarded.

So there were no dinosaurs living in mountains and humans living near the sea? ALL humans managed to get to high places and managed to stay higher than ALL prehistoric species?

There are explanations for why there are clam fossils in mountains. Look up tectonic plates you retard

And could you show me where trees are found between different geologic layers from somehwere that's not answersingenesis.com? Because I'm pretty fucking sure that would be big news in the scientific community.

>>1133470
>This thread shows that Dawkins is in fact needed.

As if you need this thread, half the population of the USA doesn't "believe in evolution".

>>1131982
>every scientific fact is a conspiracy made by the governement
>But this random picture i found on the internet (which is control by the governement) truly demonstrate that there were giant people
Keep believing you are a special snowflake boy.

File: image011.jpg (146KB, 1016x623px) Image search: [Google]

146KB, 1016x623px

>>1131063
>Lul guys, Darwin was only protecting Victorian social theory onto science
>It's not like there was actual scientific evidence behind...

>>1131522
But communism is totalitarianism

>>1131344
GCCCGAGACTATGACCATCGTACTACHATCGTGCAGCCCGAGACTGTGACCATCGTACTACATCGCAGCCCGAGACTATGACCATCGTACTACHATCGTGCAGCCCGAGACTGTGACCATCGTACTACATCGCAGCCCGAGACTATGACCATCGTACTACHATCGTGCAGCCCGAGACTGTGACCATCGTACTACATCGCAGCCCGAGACTATGACCATCGTACTACHATCGTGCAGCCCGAGACTGTGACCATCGTACTACATCGCA

>>1134597
Is this the template or non-coding strand?

>this is why I am a Catholic stalinist now

https://en.wikipedia.org/wiki/Decree_against_Communism

Time for your excommunication bro.

>>1133509
before he was a communist

why exactly does Darwin matter to the theory of evolution as it is currently understood?
He was wrong, about a hell of a lot of things even, that's why today's theory of evolution is most decidedly not Darwin's but rather the result of more than a hundred years of research by a wide variety of relevant field scientists who have properly verified evolution and its mechanics.

>>1131063

>i disagree with reality- the thread

>>1133745
Explain your logic, if the flood were true, we would find LESS marine fossils on continents?

We would find almost NO marine fossils on continents if the flood were not true.

>continents were below the seas

>mammals and dinosaurs were able to develop before the continents rose out of the sea

What I said only meant to show you that fossilization is extremely rare, it's even harder to find the fossils, and that almost all fossils we have found are not of dinosaurs or mammals. And that nearly all mammal fossils are from the ice age.

File: polystrate-fossils.png (136KB, 442x264px) Image search: [Google]

136KB, 442x264px

>>1134319
We are finding fossils of giants and people are covering it up, why would they do that?

Because they know they have been wrong.

>>1134117
>because they aren't funded by the government

Hmmmmmmmm

File: 2331.gif (544KB, 248x248px) Image search: [Google]

544KB, 248x248px

>>1135709
>Explain your logic, if the flood were true, we would find LESS marine fossils on continents?

>We would find almost NO marine fossils on continents if the flood were not true.
Because according to the flood the Earth was never covered with that amount of water before.
When the flood did come there had already been several generations of animals dying on dry land, they gotta have covered up the world when the flood finally came around. Since the marine life wasn't anywhere above land the quick rain can't have mashed them and left their fossils there.
All the animals that lived on land on the other hand should have left plenty of fossils there.

>continents were below the seas
You know how continental plates moves due to activity in the inside of Earth?
Sometimes that activity makes entire continents rise from the seas and others sink down.

>mammals and dinosaurs were able to develop before the continents rose out of the sea
They developed after that their continents rose from the seas, at which point different fishes had had quite a lot of time to die above them

,

File: 1455180900082.jpg (351KB, 1200x900px) Image search: [Google]

351KB, 1200x900px

>>1135753
>They know they will go to hell and suffer for all eternity because of it, but we still haven't seen even a single converted scientist smuggle out a bone or skull for us to see

Mhmmm?

>>1135766
>Just like those who attribute it to Aliens
Hmmmmmmmmm

>>1135802
>All the animals that lived on land on the other hand should have left plenty of fossils there.
No, fossilization is rare. Extremely.

An animal no matter what kind needs to be buried very quickly in order for fossilization to take place, still not guaranteed.

Tell me, if the world is what? 8.7~ billion years old, and we take even the most conservative sedimentary displacement rate, taking place today, where that is I'm not sure, it would be enough to completely wash all of the continents away several times over.

Secondly, why is there sedimentary rock at all on land?

It belongs in the ocean, not on the land. Why are the layers of rock perfectly flat and level?

>>1135826
>smuggling out giant fucking bones that weigh a shit load, after government agencies have already showed up and taken over. Good luck.

>>1135826
Hmm so anyone that ISN'T funded by the government has different ideas about how things happen? Interesting, very interesting.

>>1135871
>We don't got any proof at all so we will just say it's da Illuminati

>Hmm so anyone that ISN'T funded by the government has different ideas about how things happen? Interesting, very interesting.
Did I ever imply that?
And not all scientists are funded by the state, some are funded by private companies and some even by fonds from private persons.

>>1135897
And nearly all of them which aren't funded by government have their own ideas.

Tell me, how do you plan smuggling a giant fucking bone anywhere when it's under government protection?

>>1135850
>No, fossilization is rare. Extremely.
>An animal no matter what kind needs to be buried very quickly in order for fossilization to take place, still not guaranteed.
So if Fossils from land animals weren't burried quickly enough, why were Marine life that normally didn't live at land?`

>ell me, if the world is what? 8.7~ billion years old, and we take even the most conservative sedimentary displacement rate, taking place today, where that is I'm not sure, it would be enough to completely wash all of the continents away several times over.
Any source for that?

>Secondly, why is there sedimentary rock at all on land?

>It belongs in the ocean, not on the land. Why are the layers of rock perfectly flat and level?
Dish dies, leaves Fossils, land rise up above the surface. More Animals die and leave behind other sediments. Like that?

Also, why is never the bones of Dinosaurs and Humans mixed, if they lived at the same time?

>>1135913
And most of them have nothing to do with the Bible, shouldn't they all allign towards the Bible if its story is true?

>Tell me, how do you plan smuggling a giant fucking bone anywhere when it's under government protection?
Use some other guys to help you?
I mean, they all know they are going to hell if they continue like that, should be droves of people willing to defect.

>>1135920
Because they were at the bottom of various places in the ocean, and when mudslides traveling under water at 100mph came along they were buried instantly.

>Also, why is never the bones of Dinosaurs and Humans mixed, if they lived at the same time?

Many theories, fossilization is also rare. As I said in the table of what our fossil record actually shows, we haven't really found that many dinosaur fossils.

I realize it is from a "creationist" website, but read it. http://creation.com/eroding-ages#f7

>>1135929
Not everyone believes that the Bible is true.

>use some other guys even though its under armed protection and 24-7 surveillance.

>>1135929
Why don't you get some guys to help you rob a bank anon. Should be easy.

>Many theories, fossilization is also rare. As I said in the table of what our fossil record actually shows, we haven't really found that many dinosaur fossils.
Yes, and still we will found dinosaurs with other dinosaurs, never Humans with Dinosaurs or other Mammals with Dinosaurs.
Even if the chance is small for any of them to end up as Fossils as all, shouldn't the chance for a Dinosaur to end up with a Dinosaur of another species beas big for it to end up with a Mammal?

>>1135963
Okay, think you may go read this if I read that?
http://www.talkorigins.org/faqs/dalrymple/creationist_age_earth.html

>>1135976
>Not everyone believes that the Bible is true.
Yes, and these guys got proof that it is true.

>Why don't you get some guys to help you rob a bank anon. Should be easy.
I don't think my soul will burn for all eternity if I don't-

>>1136006
I wouldn't say that the chances are the same.

Deal, I'll read it now.

>>1136006
Seems like all this guy is saying is the people needed to make assumptions and literally every thing he would like to say is true is based on assumptions as well.

>>1136074
Really<?
The firt part of his argument is based on Radioactive dating and that the continental plates rise and submerge each other, the first that I haven't really seen any good arguments about it (The one argument based on that volcano involved a few scientists doing quite a bunch of error in their methods for what I have been able to read) and the second one has been pretty much noticed by Humans.
I may agree on the second one, as he do not exactly give an explanation on why.
The third argument is again based on continental shift, something that has been noticed and measured.


Also, here is a really short one just for mountains.
http://www.talkorigins.org/indexcc/CD/CD501.html

>>1136129
> Why do the continents and mountains still exist if they are being eroded so quickly? Why do so many landforms, claimed to be old, show no sign of erosion? The simple answer is that they are not as old as claimed, but ‘young’ like the Bible says. However, this is not philosophically acceptable to evolutionary geologists, so other explanations are sought—in vain.

For example, it is suggested that the mountains still exist because uplift is constantly replacing them from below.12 Consequently, the mountains would have been eroded and replaced many times over in 2.5 billion years. However, although uplift is occurring in mountainous areas, such a process of uplift and erosion could not go on for long without removing all the layers of sediments. We would therefore not expect to find any old sediment in mountainous areas if they had been eroded and replaced many times. Yet, surprisingly, sediments of all ages from young to old (by evolutionary dating methods) are preserved in mountainous regions. The idea of continual renewal by uplift does not solve the problem.

>>1133915
>Darwin
>ever at home

>Lenin
>ever not working to feed his NEET cretin friend Marx

People got shit to do and letters are more convenient.

Why do you send texts to friends who live in the same city?

>>1136155
>Lenin
>Marx
Knowing each other
I think you are mistaking someone for Engels

>>1136164
Yes I am, thanks for correcting
My point still stands. I wish /his/ discussed letters more often

>>1136143
Think I may take some time to answer this, maybe you won here.
Meanwhile I am gonna ask why we can see stars who are billions of light years away and if God stretched the universe why we can see stars being formed out there.

>>1131283
>never been observed
it has though. here is but one instance
https://en.wikipedia.org/wiki/Ring_species
even if you hate it there are many more examples

>never been tested
the entire medical field that relates to studying diseases, resistances, vaccines, etc hinges upon the evolution of the offending organisms. Antibiotic resistance would never have been a problem if evolution was not happening

>>1136322
This is probably the most difficult question.

I would recommend for you to search around for answers on your own, I don't feel I have the credibility or understanding to be okay with myself answering this.

>>1136487
I suppose it's really dump for us most of this really. It's not like either of us got any education of these subjects in a big enough depth to actually make any progress from the discussion.

>>1136500
what you could do is go to your university or alma mater and ask the geology department. They may even give you some good sources, arguments, or easier reading for the lay public that would express their view in detail

>>1136536
Yeah, but if I argue with you about it you may find something I haven't encountered before and don't know how to counter, or vice versa. The best way is to have an as open mind to it as possible, read from both sources and try to actually watch fair and equal debates about it.
Even if I am probably to much of a biased bitch to do just that.

>>1136536
What about paleontologists and geologists that are Christians? Any other field of science as well.

If you are so certain we have things correct, why are these scientists Christians?

>>1136554
Well if both parties arguing feel they don't know enough about said material everybody could ask the person closest to them that is in the field so to speak and then reconvene. You could find out things you didn't know before and then share with the class, and if everyone does that then we have more points for discussion (with sources of course)

>>1136558
what about them? as long as they're actually in the field and not armchair geologists or something I see no problem with asking them as well. Any scientist worth their salt will acknowledge multiple possibilities to a problem if it seems to be complex or not totally understood yet. I'm not so certain everything is correct, but I am certain that these topics are being studied otherwise scientific journals wouldn't be published with articles about the topics and thus there would be nobody willing to teach it.

As a side note, you can think whatever you want about the age of the earth, how life changes, evolution, etc and still be christian or have faith.

I do wonder, all the trolling in this thread aside, how anyone in a western nation with sufficient educational standards and freedom of information could possibly try to deny evolution.
After all there is not only a significant amount of proof but also direct applications that require evolution to function.
I can understand if you grew up in an environment where information about evolution is quite literally impossible to attain but in a western nation?

File: 1462849904338.jpg (1MB, 1912x1536px) Image search: [Google]

1MB, 1912x1536px

>>1136720
People who are outside of biology tend to have extremely warped views of what evolutionary theory is based on pop science and the media (also see: "If we evolved from monkeys how come there are still monkeys?!")

Also, some people outside of this department who also have attachments to a creation religion are vehemently opposed to any idea of all things not being carefully and unchangingly constructed by a creator deity. In the same way, people around Galileo's time thought that the acceptance of the heliocentric model would put an end to faith in the bible because they viewed his theory as direct contradiction to the words in the bible. In time, however they grew to accept it. In the same way, this will also probably happen with evolutionary theory seeing as how its understanding is necessary for medical science, conservation ecology, and many many other disciplines

Here, have a funny strawman comic that for some reason people take seriously

>>1136777
is that a real comic?
because it feels fake, the sheer amount of strawmanning and obvious misinformation make it seem like its a parody of some sort

>>1136798
I thought I had the source on the last version I saved but I can't seem to find it on this one.

If this particular one IS a fake it unfortunately does mimic similar serious ones quite well. The people who make these of course try to make the theory seem as watered down and ridiculous as possible to make people reading think "Oh, of course that logically COULDN'T be true! This just seems silly!"

In a real one we read way back in high school, they implied that the theory entailed modern day cows walking into the ocean, losing legs and gaining blowholes in less than one generation.

>>1131403
This board. Wew.
>>1131982 >>1131998 >>1132022

STAY
W O K E
O K E W
K E W O
E W O K

>>1131934
>>1131982
>>1131998
Even if these were real wouldn't they be more likely proving the old greek mythos of creation true instead of the christian creationism? They had way more giants and titans and shit in that religion.

Still, funny shoops

>>1136823
well I for one do hope this one is satire because if its not and its actually meant to criticize evolution it goes well beyond mere ignorance and straight down to malevolence

>>1136798
>>1136823
>>1136844
https://www.chick.com/reading/tracts/0055/0055_01.asp
It's real.

>>1136844
Indeed it does. Notice how the boy becomes more and more aryan-looking as the panels go by and the professor has stereotypical jewish features. If it's not satire (I really don't think it is unfortunately) then the creator has other deep-rooted problems

>>1136853
thank you, based anon.
Though I feel instantly dumber for exploring that site.

File: Image24[1].gif (36KB, 378x200px) Image search: [Google]

36KB, 378x200px

>>1136897
And you haven't even reached the bottom of the rabbit hole?

>>1136867
Didn't even notice that over the sheer amount of what apparently is deliberate misinformation in this "work".
I mean, anyone with even the most basic knowledge of any of the fields he attacks in this comic could easily shred his arguments into little pieces but the way its presented its goal is not only to convince someone of a particular point of view but also preemptively shut down any and all discussion regarding the validity of said point of view.
In fact some of the errors presented are so fundamental I cannot believe he isn't aware that his statements are factually wrong.

File: GG.gif (9KB, 239x141px) Image search: [Google]

9KB, 239x141px

>>1136867
>>1136905
I am rather sure it's more about those traits being stereotypical Professor traits, unless the man manages to keep a rather big amount of ideological dissonance. He wrote this after all.

>>1136905
I think at some level he might. He's aimed to build up a really shitty argument himself to knock it down easily in a comic.

>>1136904
lol holy shit. literally.

File: Russian revolution.gif (34KB, 468x240px) Image search: [Google]

34KB, 468x240px

>>1136983
there is only one way for you to reach the bottom of this Rabbit hole.

>>1137003
I really like it when he quotes his own comics in his comics and then sources them like a good boy

File: 1078_19.gif (29KB, 468x240px) Image search: [Google]

29KB, 468x240px

>>1137039
I have heard he is actually supposed to do that by law.
You got to source your sources, even if you yourself made them.

Also, here's a research paper for those interested.
tp://danielraeburn.com/The_Imp,_by_Daniel_Raeburn_files/Imp_JTC.pdf