Anonymous
Humanity's Representatives 2017-02-20 09:06:02 Post No.8689854
[Report] Image search: [Google]
Humanity's Representatives 2017-02-20 09:06:02 Post No.8689854
[Report] Image search: [Google]
File: simonandjose.jpg (112KB, 679x720px) Image search:
[Google]
112KB, 679x720px
Humanity's Representatives
Anonymous
2017-02-20 09:06:02
Post No. 8689854
[Report]
[View this topic]
So, NASA will soon reveal we are not alone in this galaxy. Who do we send forth to represent our species - our keenest politicians, our brightest linguists, our genius physicists or our most knowledgeable anthropologists? (I nominate a mullah, a beekeeper and a drunk Chinaman.)
https://www.nasa.gov/press-release/nasa-to-host-news-conference-on-discovery-beyond-our-solar-system/
27 Posts / 3 Images
View this topic
>>
>>8689854
/pol/
>>
Send a gay couple so those alien fuckers don't find out how we reproduce.
>>
>>8689854
No no... We send Filthy Frank.
MFW
Georgia approves GPA boost for stem majors 2017-02-20 07:41:45 Post No.8689659
[Report] Image search: [Google]
Georgia approves GPA boost for stem majors 2017-02-20 07:41:45 Post No.8689659
[Report] Image search: [Google]
File: 1483862321706.png (46KB, 619x453px) Image search:
[Google]
46KB, 619x453px
Georgia approves GPA boost for stem majors
MFW
2017-02-20 07:41:45
Post No. 8689659
[Report]
[View this topic]
TFW when you worked hard to earn a 3.0 GPA as a math major and now the gpa boost makes you look like an even bigger dumbass.
11 Posts / 4 Images
View this topic
>>
>>8689659
Wew...Georgia's labs are gonna be filled with incompetents now.
>>
>>8689659
http://getschooled.blog.myajc.com/2016/02/03/good-news-for-georgia-tech-house-approves-giving-stem-majors-bump-in-their-hope-gpa/
This is stupid. They should depreciate liberal art courses by 0.5 instead.
>>
>>8689659
Really? When does this kick in? I'm in Georgia and I'm in a STEM major. I'm a total dumbass but the average student is even dumber than me, at least at this school. I think GA tech has a lot of smart people tho
hello there /lit/ emigrate here, I want to get into computer science, any recommendations for this? any interesting books or lectures that would get me going on the path of /compsci/ ? I've had enough of liberal arts cuckery.
46 Posts / 11 Images
View this topic
>>
>>8689353
>I've had enough of liberal arts cuckery.
Not gonna make it.
>>
>>8689353
Introduction to the the theory of computation is a really easy and readable book
>>
>>8689353
What do you mean by compsci ? Actual science or programming computers ?
File: HorizonDistance.png (71KB, 1005x546px) Image search:
[Google]
71KB, 1005x546px
Bang! If the earth is flat, how can you measure heights and distances across the horizon, a simple task that has been done daily for hundreds of years by sailors all around the world?
12 Posts / 1 Images
View this topic
>>
>>8689161
Ships are fake and the sailors are in on the lie, together with all the pilots.
>>
Why spend the time or energy trying to "refute" trolls and paid shills?
>>
>>8689405
Wait, who the fuck would pay for FE-shills?
Anonymous
Men continue to out perform women in mathematics. 2017-02-20 05:20:01 Post No.8688509
[Report] Image search: [Google]
Men continue to out perform women in mathematics. 2017-02-20 05:20:01 Post No.8688509
[Report] Image search: [Google]
File: CqirhLlWAAAIWLQ.jpg (90KB, 882x882px) Image search:
[Google]
90KB, 882x882px
Men continue to out perform women in mathematics.
Anonymous
2017-02-20 05:20:01
Post No. 8688509
[Report]
[View this topic]
http://www.aei.org/publication/2014-math-sat-test-results-confirm-pattern-persisted-40-years-boys-better-math-girls/
How do we fix this? I was thinking we need some way to alter female brains with more male-style hormones. Perhaps while in womb.
11 Posts / 1 Images
View this topic
>>
What's there to fix?
>>
>>8688509
Just genetically engineer men that have both vago and penor. """"problem"""" solved
>>
>>8688509
A better solution is to alter male brains. Testosterone must be outlawed and feti must be castrated.
File: IMG_20170218_155947.jpg (3MB, 4160x3120px) Image search:
[Google]
3MB, 4160x3120px
Hello. I have a cipher that needs to be solved. I have been sat for hours attempting to decode this but have not been able to.. maybe somebody on this board will be of some help. In the pastebin is a link to all the numbers, and yes the last character does seem to be a flipped 9. Maybe it's some kind of key?
26 Posts / 2 Images
View this topic
>>
>>8687648
The pastebin link with all of the numbers can be found here http://pastebin.com/rFFYHa71
>>
>>8687648
What have you tried so far?
>>
>>8687655
Getting the sum of each row/column, linking the numbers to letters in the alphabet A=0, Z=26 (but that doesn't work since the numbers are 0-9).
Latin Square (that doesn't work since numbers appear more than once).
I've really been working on the other ones more. I still have no idea what the final character is for.
File: C5CXYlHUoAUPGwX.jpg (442KB, 2048x1365px) Image search:
[Google]
442KB, 2048x1365px
Baby came back
https://twitter.com/elonmusk/status/833332058453790720
67 Posts / 10 Images
View this topic
>>
fake
>>
>>8686989
USA USA USA USA USA
>>
>>8686990
So's your post.
File: fig05_18.gif (13KB, 314x384px) Image search:
[Google]
13KB, 314x384px
Taking physics for the first time and this bugs me even though it's correct. Normally sin corresponds to the y-axis and cos corresponds to the x-axis. But why is it that in some cases it's the opposite like in pic related?
17 Posts / 2 Images
View this topic
>>
>>8685768
Because θ is oriented differently
>>
>>8685773
Could you explain further? I get that it's oriented differently but I'm not finding it to be an intuitive reason.. Would it make sense to say that the direction the object is "falling" is the direction of the y-axis? At least I could feel at ease with that.
>>
>>8685795
One angle is measured from the vertical and one is measured from the horizontal, so the components of each are flipped. Just look at the picture and remember soh cah toa. There's nothing intrinsically "vertical" about the function sin(x)
File: Gene_side2.jpg (11KB, 220x247px) Image search:
[Google]
11KB, 220x247px
Let's say you can modify your genome, what specifically do you change? If you can't provide nucleotide sequences for your proposed changes RIGHT NOW, don't even bother posting
85 Posts / 7 Images
View this topic
>>
yeah no one is gonna post in this thread you know
>>
>>8678951
I want to add photosynthetic genes from plants into my skin so I become autotrophic
>>
>>8678951
ATGGTGCACCTGACTCCTGTGGAGAAGTCYGCNGTTACTGCNYTNTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCAGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC
CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA
CATTTATTTTCATTGC
Change to
ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCGGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAG
TTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGG
GGATCTGTCCACTCCTGATGCAGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGT
GCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACT
GTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCA
TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAAT
GCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCC
CTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAA
CATTTATTTTCATTGC
File: download (2).jpg (11KB, 270x186px) Image search:
[Google]
11KB, 270x186px
ayy yo hol' up
>Solid water = ice
>Gasious water = vapor
>liquid water = just water?
The word "water" to refer to liquid H2O is a misnomer because, technically, all the others are water, just not liquid.
Does liquid water have it's own name I don't know about?
11 Posts / 2 Images
View this topic
>>
>>8689798
>>Gasious water = vapor
no, it's steam. Vapor is just another word for gas.
>>
>>
>>8689798
>Does liquid water have it's own name I don't know about?
Yes. It's called spoom.
File: IMG_1044.jpg (842KB, 3000x2250px) Image search:
[Google]
842KB, 3000x2250px
How does a vector table help us get the length of a a vector and the value of an angle theta. I understand the law of sines somewhat, like it tells us the ratio between the sin of each of these angles + the length of the opposite side is constant so sin a/A = sin b/B = sin c/C. Can someone check out this problem and tell me how to approach finding vector D?
13 Posts / 2 Images
View this topic
>>
File: IMG_1071.jpg (1MB, 4032x3024px) Image search:
[Google]
1MB, 4032x3024px
>>8689735
Here's the vector table I made for it. I don't get how I obtain the length of the vector in question and the value of the angle theta from this information. I get the sum of the x and y components of the other vectors in the table are the x and y components of the vector in question, but where do I go from there. How does this help me find its length and theta?
>>
>>8689735
Halp
>>
Sum of all y components = 0
Sum of all x components = 0
Create a system of equations using this and solve for D and theta
File: _fall2016hhhhhhhh.png (806KB, 2372x2560px) Image search:
[Google]
806KB, 2372x2560px
Hello, Youth. I've been out in the desert doin' science. Didn't meet any women, though. Should have started in 2010 instead of 1990...
14 Posts / 10 Images
View this topic
>>
File: BlackMesaOklahoma.jpg (444KB, 2000x1802px) Image search:
[Google]
444KB, 2000x1802px
A little OC here from my posted lesson stuff.
>>
File: PleaseNoEatin'NoTypin'.jpg (69KB, 727x441px) Image search:
[Google]
69KB, 727x441px
My students. I take them to the lonely mesas and they become educated when they lose their phone signal
>>
File: Well that you might saye thatt my Writing is less Succinct.jpg (982KB, 2066x2549px) Image search:
[Google]
982KB, 2066x2549px
Unfortunately we have no state religion to provide me with a living while I tell the curate to do the preachin' and buryin' and I'm gonna go to Sicily to look at volcanoes.
Anonymous
Why is Elon Musk so retarded? 2017-02-14 05:57:42 Post No.8674469
[Report] Image search: [Google]
Why is Elon Musk so retarded? 2017-02-14 05:57:42 Post No.8674469
[Report] Image search: [Google]
File: Hyperloop-One-Event-12[1].jpg (1MB, 1500x1000px) Image search:
[Google]
![Hyperloop-One-Event-12[1].jpg](https://i.imgur.com/vZmpnXP.jpg "Hyperloop-One-Event-12[1]")
1MB, 1500x1000px
Why is Elon Musk so retarded?
Anonymous
2017-02-14 05:57:42
Post No. 8674469
[Report]
[View this topic]
https://www.youtube.com/watch?v=RNFesa01llk
178 Posts / 17 Images
View this topic
>>
>>8674469
Megalomaniac.
>>
>>8674469
> be me
> muslim mudlsime
> just arrive to americuck and looking for something to bomb
> see giant pressurized american gas tube full of innocnets
> allahwillsit.cp
> throw a lethal 1 metric kg brick at it
> boom.govaid
> entire thing blows up hundreds killed
> falcon 9 v2
> NASA keks
>>
>>8674505
You could do the same thing to a bus or a train
Retarded argument, back to >>>/reddit/ you go
File: Capture.png (17KB, 387x276px) Image search:
[Google]
17KB, 387x276px
So, how long will I have to study until I start getting all the memes here on /sci/?
14 Posts / 3 Images
View this topic
>>
>>8690161
2 days
>>
>>8690161
[math]2(U+Op)-2(4+E+V+A)[/math]
>>
>>8690161
What website is this?
File: 7584375.jpg (60KB, 700x700px) Image search:
[Google]
60KB, 700x700px
>tfw born in the wrong generation
I've always wanted to study extraterrestial organisms, but no space program seems to be serious about drilling inside Europa or Enceladus to try and find life in other worlds in the near future
I'm 18 but I feel like the opportunity to study the insides of moons like Europe and Enceladus will not happen in my lifetime
18 Posts / 1 Images
View this topic
>>
There's no life beyond earth, so you aren't missing anything.
>>
>>8690146
Here comes the bait.
>>
>>8690146
The chance that Earth is the only place in the universe where life exists is unlikely