[Boards: 3 / a / aco / adv / an / asp / b / bant / biz / c / can / cgl / ck / cm / co / cock / d / diy / e / fa / fap / fit / fitlit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mlpol / mo / mtv / mu / n / news / o / out / outsoc / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / spa / t / tg / toy / trash / trv / tv / u / v / vg / vint / vip / vp / vr / w / wg / wsg / wsr / x / y ] [Search | Free Show | Home]

Archived threads in /sci/ - Science & Math - 1245. page

This is a blue board which means that it's for everybody (Safe For Work content only). If you see any adult content, please report it.

What's the best way to amplify DNA with high GC content? Here's the sequence.

5' GCACCGGGCAGGGACGTCCGGGAGGGC 3'

Also, I'm designing primers right now, and I know the standard is usually 18-22 bp. Given that this is so small, what do? I'm an undergraduate and I haven't had a lot of experience running PCR on oligos. Thanks.
6 posts and 2 images submitted.
>>
http://bitesizebio.com/24002/problems-amplifying-gc-rich-regions-problem-solved/
>>
>>8463934
Thanks mate. I actually just read this earlier. However, I have found very little information regarding the design of primers for a sequence so small. Any input would be immensely helpful.
>>
>I know the standard is usually 18-22 bp
in cases like this, fuck the standard

what matters is GC, Tm, and specificity. If you can find a shorter primer that has a reasonable GC content and Tm but is still specific to your sequence, there's no reason not to at least try it. Primers are cheap.

in this case though, what I'd do is just try to change up my project so I avoided that problem sequence. You'll waste more time trying to optimize this trouble primer and the PCR reaction than you would just tossing a little work out and avoiding the problem in the first place.

File: STEM.jpg (152KB, 650x242px) Image search: [Google]
STEM.jpg
152KB, 650x242px
What're the most lucrative STEM professions within /sci/'s objective opinion?
31 posts and 3 images submitted.
>>
PetroE
Bachelors, $100k starting
>>
>>8463827
What about nuclear engineering or mathematics?
>>
>>8463827
lol, no. i go to the best Petro E school in the country and our placement rate is abysmally low. those 100k + starting salaries ended when oil tanked to 40$ a barrel.

File: 1455467346895.jpg (84KB, 660x330px) Image search: [Google]
1455467346895.jpg
84KB, 660x330px
>problem requires unique ""trick"" that isn't obvious and could of only been known if you had prior knowledge of it
7 posts and 2 images submitted.
>>
>could of
>>
> requires unique ""trick""
how do you know its unique?
>>
>could of

brainlet confirmed

Sup nerds,

Why aren't you doing a double major in Math and Computational Theory, anon?

>Math enables you to think abstractly and understand eternal truths (I don't need to convince you guys why math is best tier)
>CS makes you employable, and by specializing in theory, you don't have to get a code monkey job.

How is this not the best STEM combination? I get to do this and graduate in 4 years at U of T(Math major + CS specialist with focus in Theory of computation)
8 posts and 4 images submitted.
>>
File: CS guide.png (178KB, 1068x1142px) Image search: [Google]
CS guide.png
178KB, 1068x1142px
>>8463693
Because undergrad CS is a horrific waste of time. Just self study it.
>>
>>8463704

You could make a list like this for literally any program of study.

>Implying CS = programming
>>
File: CS.png (886KB, 1170x500px) Image search: [Google]
CS.png
886KB, 1170x500px
>>8463822
>>Implying CS = programming
>Too stupid to read the image

CS is a joke

File: opposite1.jpg (1KB, 200x197px) Image search: [Google]
opposite1.jpg
1KB, 200x197px
Why do we have minus numbers?
33 posts and 2 images submitted.
>>
Because closure is a useful property.
>>
I like to think of the number line like a time line, minus is past, 0 is present and regular numbers are the future. The past goes on and it obviously exists. Also there is the concept of debt. You can owe someone cash but you wouldn't say I have 0 dollars when in debt, you would say I have negative x dollars. As soon as you get x amount you have 0 dollars, where as if you begin with 0 dollars and receive x amount...you have x amount of dollars.
>>
>>8462502
You owe me ten dollars and at this moment you are broke.

You have -10 dollars in your account.

File: 1475596325576645862.jpg (64KB, 438x267px) Image search: [Google]
1475596325576645862.jpg
64KB, 438x267px
>real analysis class
>Prof uses things that weren't yet thoroughly defined "because you should know that from school"
>He fails you if you use some things and theorems from school "because we didn't define them yet"
36 posts and 2 images submitted.
>>
This is a complaint for your school's math department, not /sci/
>>
>>8462458
Maybe you just suck at determining what is trivial and what is you being a lazy fuck
>>
>>8462458
Cite what theorem you're using, don't just use a result implicitly in your proof.

File: PqD9V8km_400x400.png (313KB, 400x400px) Image search: [Google]
PqD9V8km_400x400.png
313KB, 400x400px
In the end, is the net effect of popscience actually damaging or helping (real) science?
31 posts and 3 images submitted.
>>
Damaging. Needs more math. Normies think science is shit you discuss between bong hits.
>>
>>8461609
>>
>>8461604
Helping. A lot of redditors think they 'just totally get it, man' and go study math or physics to then only pay the big bucks a couple of the first semestees (the ones that are cheapest for the uni to keep but cost just as much as the future semesters for the students) and give money to our programs and then they just leave, giving our departments huge profit margins that they can use to fund us.

At my uni the stop students get paid a monthly salary funded right from brainlet pockets.

File: bookshelf.jpg (1MB, 6000x5312px) Image search: [Google]
bookshelf.jpg
1MB, 6000x5312px
Show us your place of knowledge
59 posts and 12 images submitted.
>>
wow! you must be really smart
>>
File: library.png (529KB, 640x1136px) Image search: [Google]
library.png
529KB, 640x1136px
>>8458921
Here is my bookshelf you fucking faggot.

You are either really old or really stupid lol. Not only are your books infinitely more expensive than mine, they take more space and will cause you trouble sometime in the future when you need to move or have to re-order to accomodate for more useful furniture.

>The "real books" industry still going strong in 2016 selling only to retards.

I wonder if only retards buy books, or if buying books makes you a retard.

What does /sci/ think?
>>
>>8458953
Books are an aesthetic element in a room, faggot.

Also, take your pedophile calculus book to >>>/a/.

File: 1454383018502.jpg (70KB, 500x600px) Image search: [Google]
1454383018502.jpg
70KB, 500x600px
Hey /sci/, In my university my professors have been telling me that there is no biological difference in races and that it's a cultural difference. They tell me that science has proved this and that there is no genetic difference between races. This is obviously retarded, and I was wondering if there were any studies you could point me towards that disproves this theory. I've recently seen on /his/ discussions on different genes that show a person's ethnicity. I vaguely remember seeing them labeled as one letter and then two numbers to specify. I know this may be a little vague, but I appreciate any help you can give me.
78 posts and 6 images submitted.
>>
>>8457938

if you look in genetics studies youll find that the truth is somewhere in the middle. ofcourse there is variation between people across geographical space but there is no scientific way to divide these into non-arbitrary racial groups.
>>
>>8457938

https://scholar.google.co.uk/scholar?q=race+human+diversity+genetics&btnG=&hl=en&as_sdt=0%2C5

this search will probably have studies you will want to look for, using an unbiased search
>>
>>8457938

i dont think theres any genes that show a persons ethnicity. it wouldnt make sense.

File: ice cubes.jpg (11KB, 300x260px) Image search: [Google]
ice cubes.jpg
11KB, 300x260px
So my apartment water is shut off for a few hours. I'm thirsty and don't have anything to drink, but, I have two ice cube trays. Can I microwave ice cubes? I've heard they can explode in a microwave but idk if that's true...
14 posts and 1 images submitted.
>>
>>8463457
Yea sure, why not just also place them onto a metal pot and heat that with a stove-top burner, like one would normally boil water?
>>
>>8463459
unfortunately I only have one pot and it's dirty. And I can't clean it because no water to clean with :(
>>
>put ice cubes in a clean glass
>put glass on top of or near a heat source (body, PC, heater, lamp)
>drinkable cold water

File: 1473228225631.jpg (186KB, 319x776px) Image search: [Google]
1473228225631.jpg
186KB, 319x776px
I finished learning high school maths. Now I want to learn some basic set theory. Is there a good book for this level that also has solutions to the exercises/proofs?
7 posts and 2 images submitted.
>>
>>8463345
short reviews across a wide variety of topics, a few deal with set theory
https://www.ocf.berkeley.edu/~abhishek/chicmath.htm

the above link may not provide you with what you are looking for right now, still worth looking at

best of luck
>>
>>8463345
What material did you use to learn the high school math? I don't study formally right now because wife is in college but I've been looking for good resources to relearn middle and high school math, and maybe science.

Good luck on your search.
>>
>>8463354
Thanks!

Is there a name for this "trick" or more general method to know that the product of the numerators is that cubic difference? Other than simply multiplying through and cancelling.
I'm pretty sure someone explained to me a way to know it.
7 posts and 1 images submitted.
>>
>>8463308
Use (a + b)^n =(n choose k)a^kb^(n-k)
>>
>>8463311
Not sure I see it. Wouldn't it need to be 2ab for binomial theorem?
>>
>>8463308
I'd stick with multiplying

File: frog.jpg (8KB, 251x242px) Image search: [Google]
frog.jpg
8KB, 251x242px
>"""""law""""" of large numbers
8 posts and 1 images submitted.
>>
>it's actually a theorem.
>>
>define """""large"""""
>>
>>8463298
Isn't it technically "the sum of a large number of uniform random variables will tend toward a normal random distribution"?

File: Capture.png (276KB, 692x794px) Image search: [Google]
Capture.png
276KB, 692x794px
Have you done a test like this? Do you think choosing a candidate in this manner is more in line with the scientific method?

I imagine if we replaced the current election system with something like this, people would be less blinded by the rhetorics and charisma of a candidate (or lack thereof), which causes people to vote with their feelings instead of rationally.

Also I dont intend to argue about wether or not I ticked the right boxes, to keep this from becoming too /pol/.
6 posts and 1 images submitted.
>>
>>8463271
it unfortunately doesn't matter as long as there's first past the post voting.

Also I think there is a bias you have to worry about
>>
>>8463271
I did some months ago. I remember that I sided as much with Trump as I did with Hillary and Bernie was the guy I sided with the most.

That felt sad. The media would give you the impression that Trump is the anti Hillary and Hillary is the anti trump but aside from a couple meme issues like 'muh wiimmenzz' they are pretty much equivalent.

Proof of how the supposed left is just the center right. Democrats are just republicans who care a little more about personal rights and thus support stuff like gay marriage, unlike republicans who see personal rights as non issues.
>>
>>8463274
What bias do you mean? The one from the site or from me kind of not wanting to align with Hillary?

And what do you think about the idea to replace elections with a test like this, and candidates with ideas?

File: IMG_1680.jpg (133KB, 960x723px) Image search: [Google]
IMG_1680.jpg
133KB, 960x723px
I tried to bleach my hair blonde. I left it on for 50 minutes, and it was a clear color so I couldn't tell that a chunk landed on my skin. Now the actual hair is an ugly brassy color, but obviously I'm afraid to put any more chemical (toner) on my hair because I don't wanna make the blistering worse.

What can I do? Also; will it leave scarring? It hurts pretty bad. It's been 5 hours. There was a bubble at first that went away.

Any advice, thanks.
9 posts and 3 images submitted.
>>
File: IMG_1657.jpg (255KB, 2075x1077px) Image search: [Google]
IMG_1657.jpg
255KB, 2075x1077px
Fivehead; I guess from a distance it doesn't look horrible.
>>
still kind of deep. flash with cold water to neutralize ph balance. don't put anything on it in case of mixing with the bleach.

then is up to vitamins and exercise to push the skin cells up,flake off the old ones, and get rid of the scar.
>>
File: 1453418842876.png (186KB, 600x600px) Image search: [Google]
1453418842876.png
186KB, 600x600px
>>8462981


-poor cold water on it
-neutralize with solution with basic ph, like baking soda in water
-put creams for burns, like pic
-put cream/ointment to moisturize, like hydromol or some biafine
-when going out, put sun screen, like spf 50

Pages: [First page] [Previous page] [1235] [1236] [1237] [1238] [1239] [1240] [1241] [1242] [1243] [1244] [1245] [1246] [1247] [1248] [1249] [1250] [1251] [1252] [1253] [1254] [1255] [Next page] [Last page]

[Boards: 3 / a / aco / adv / an / asp / b / bant / biz / c / can / cgl / ck / cm / co / cock / d / diy / e / fa / fap / fit / fitlit / g / gd / gif / h / hc / his / hm / hr / i / ic / int / jp / k / lgbt / lit / m / mlp / mlpol / mo / mtv / mu / n / news / o / out / outsoc / p / po / pol / qa / qst / r / r9k / s / s4s / sci / soc / sp / spa / t / tg / toy / trash / trv / tv / u / v / vg / vint / vip / vp / vr / w / wg / wsg / wsr / x / y] [Search | Top | Home]

I'm aware that Imgur.com will stop allowing adult images since 15th of May. I'm taking actions to backup as much data as possible.
Read more on this topic here - https://archived.moe/talk/thread/1694/


If you need a post removed click on it's [Report] button and follow the instruction.
DMCA Content Takedown via dmca.com
All images are hosted on imgur.com.
If you like this website please support us by donating with Bitcoins at 16mKtbZiwW52BLkibtCr8jUg2KVUMTxVQ5
All trademarks and copyrights on this page are owned by their respective parties.
Images uploaded are the responsibility of the Poster. Comments are owned by the Poster.
This is a 4chan archive - all of the content originated from that site.
This means that RandomArchive shows their content, archived.
If you need information for a Poster - contact them.